Incidental Mutation 'R0632:Mmp13'
ID 59718
Institutional Source Beutler Lab
Gene Symbol Mmp13
Ensembl Gene ENSMUSG00000050578
Gene Name matrix metallopeptidase 13
Synonyms interstitial collagenase, Collagenase-3, collagenase-1, MMP-13, Mmp1, Clg
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.206) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 7272514-7283331 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 7274032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 169 (G169R)
Ref Sequence ENSEMBL: ENSMUSP00000015394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015394]
AlphaFold P33435
PDB Structure STRUCTURE OF RECOMBINANT MOUSE COLLAGENASE-3 (MMP-13) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000015394
AA Change: G169R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015394
Gene: ENSMUSG00000050578
AA Change: G169R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 33 92 5.3e-13 PFAM
ZnMc 110 269 3.76e-59 SMART
HX 291 333 9.62e-8 SMART
HX 335 378 9.91e-10 SMART
HX 383 430 2.52e-11 SMART
HX 432 472 1.81e-3 SMART
Meta Mutation Damage Score 0.2928 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family that plays a role in wound healing, skeletal development and bone remodeling. The encoded protein is activated by the removal of an N-terminal activation peptide to generate a zinc-dependent endopeptidase enzyme that can cleave various native collagens, including types I - IV, X and XIV. Mice lacking the encoded protein display profound defects in growth plate cartilage as well as a delay in the endochondral bone development. Lack of the encoded protein also impairs the wound healing process due to reduced keratinocyte migration and vascular density at the wound site. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygous null mice display increased width of hypertrophic chondrocyte zone and increased trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Mmp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Mmp13 APN 9 7,278,974 (GRCm39) splice site probably benign
IGL02027:Mmp13 APN 9 7,272,955 (GRCm39) missense probably damaging 1.00
IGL02320:Mmp13 APN 9 7,278,941 (GRCm39) missense probably benign 0.00
R0143:Mmp13 UTSW 9 7,276,558 (GRCm39) missense probably damaging 1.00
R0417:Mmp13 UTSW 9 7,276,602 (GRCm39) missense probably benign
R0505:Mmp13 UTSW 9 7,272,929 (GRCm39) missense probably damaging 1.00
R0624:Mmp13 UTSW 9 7,280,221 (GRCm39) missense possibly damaging 0.69
R0632:Mmp13 UTSW 9 7,282,077 (GRCm39) missense possibly damaging 0.74
R1102:Mmp13 UTSW 9 7,272,952 (GRCm39) missense possibly damaging 0.55
R1387:Mmp13 UTSW 9 7,282,033 (GRCm39) missense possibly damaging 0.60
R1478:Mmp13 UTSW 9 7,272,892 (GRCm39) missense probably damaging 1.00
R1669:Mmp13 UTSW 9 7,277,926 (GRCm39) missense probably benign 0.01
R4647:Mmp13 UTSW 9 7,274,233 (GRCm39) missense probably damaging 1.00
R4648:Mmp13 UTSW 9 7,274,233 (GRCm39) missense probably damaging 1.00
R4668:Mmp13 UTSW 9 7,272,580 (GRCm39) missense possibly damaging 0.54
R4827:Mmp13 UTSW 9 7,278,880 (GRCm39) missense possibly damaging 0.68
R4898:Mmp13 UTSW 9 7,272,953 (GRCm39) missense probably benign 0.10
R5780:Mmp13 UTSW 9 7,278,952 (GRCm39) missense possibly damaging 0.76
R5946:Mmp13 UTSW 9 7,276,580 (GRCm39) missense probably damaging 1.00
R5996:Mmp13 UTSW 9 7,274,269 (GRCm39) missense probably damaging 1.00
R6102:Mmp13 UTSW 9 7,276,688 (GRCm39) missense probably benign 0.07
R6693:Mmp13 UTSW 9 7,280,245 (GRCm39) missense probably benign 0.00
R6789:Mmp13 UTSW 9 7,272,781 (GRCm39) missense probably benign 0.00
R7310:Mmp13 UTSW 9 7,280,880 (GRCm39) missense possibly damaging 0.60
R7728:Mmp13 UTSW 9 7,274,004 (GRCm39) missense probably benign
R8041:Mmp13 UTSW 9 7,280,865 (GRCm39) missense probably benign 0.13
R8314:Mmp13 UTSW 9 7,272,931 (GRCm39) missense probably damaging 1.00
R8324:Mmp13 UTSW 9 7,276,636 (GRCm39) missense possibly damaging 0.75
R8684:Mmp13 UTSW 9 7,282,089 (GRCm39) missense possibly damaging 0.51
R8755:Mmp13 UTSW 9 7,277,996 (GRCm39) missense possibly damaging 0.51
R9365:Mmp13 UTSW 9 7,277,921 (GRCm39) missense probably benign 0.02
T0722:Mmp13 UTSW 9 7,280,857 (GRCm39) missense possibly damaging 0.67
Z1177:Mmp13 UTSW 9 7,280,200 (GRCm39) missense possibly damaging 0.89
Z1177:Mmp13 UTSW 9 7,277,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCCATTTCAAGTTGAAAAGCAAT -3'
(R):5'- GCAGACAGCAAGAGTTAGAGTCCCA -3'

Sequencing Primer
(F):5'- agccatctcaccagtccc -3'
(R):5'- CCTGACTTGGCAGCTTTTTC -3'
Posted On 2013-07-11