Incidental Mutation 'R7750:Usf3'
ID597180
Institutional Source Beutler Lab
Gene Symbol Usf3
Ensembl Gene ENSMUSG00000068284
Gene Nameupstream transcription factor family member 3
SynonymsLOC207806, Gm608, LOC385650, 5530400K22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R7750 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location44173246-44227465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44220521 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1788 (E1788G)
Ref Sequence ENSEMBL: ENSMUSP00000112620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119746] [ENSMUST00000169582]
Predicted Effect probably benign
Transcript: ENSMUST00000119746
AA Change: E1788G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112620
Gene: ENSMUSG00000068284
AA Change: E1788G

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169582
AA Change: E1788G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128627
Gene: ENSMUSG00000068284
AA Change: E1788G

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,200 D816V possibly damaging Het
Abca16 A T 7: 120,514,705 N933I probably benign Het
Acly A T 11: 100,478,013 probably null Het
Acox1 C T 11: 116,183,580 G105D possibly damaging Het
Ankrd24 A G 10: 81,646,794 E939G possibly damaging Het
Brd4 G T 17: 32,213,547 N579K unknown Het
C1qc T C 4: 136,890,281 Y168C probably damaging Het
Casp6 A G 3: 129,912,209 D175G probably damaging Het
Ccdc83 A T 7: 90,223,982 Y388* probably null Het
Cox4i1 A G 8: 120,673,310 I111V probably benign Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Epb41l4b C T 4: 57,076,913 probably null Het
Frem2 C A 3: 53,523,682 L2743F possibly damaging Het
Frmd4a A T 2: 4,601,349 H628L probably benign Het
Fyb A G 15: 6,660,703 D809G probably damaging Het
Gm19410 T A 8: 35,807,498 M1491K possibly damaging Het
Gm3604 G A 13: 62,369,996 H183Y possibly damaging Het
H1fnt A G 15: 98,256,684 S195P unknown Het
Lama2 T C 10: 26,990,924 Y2858C probably damaging Het
Methig1 T C 15: 100,353,531 F108L probably benign Het
Mfsd4b5 A G 10: 39,970,255 V443A probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myh9 C T 15: 77,783,410 V608I probably benign Het
Myo1g T C 11: 6,514,849 D475G probably damaging Het
Nlrp1b T A 11: 71,168,839 I769F probably benign Het
Nol8 G T 13: 49,662,266 V617F possibly damaging Het
Olfr715b A T 7: 107,106,533 C109* probably null Het
Pik3r2 A G 8: 70,770,901 F346S probably damaging Het
Pou3f3 T A 1: 42,698,148 F335I probably damaging Het
Ppp1r3e T C 14: 54,876,627 D196G probably damaging Het
Prpf40a T C 2: 53,151,745 T545A probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rprd1a T A 18: 24,508,254 K102* probably null Het
Sim1 A G 10: 50,896,035 T47A possibly damaging Het
Slc45a1 C T 4: 150,644,041 A102T probably damaging Het
Slc6a11 C T 6: 114,230,137 P361S possibly damaging Het
Slc9b2 T C 3: 135,326,237 F286S probably damaging Het
Slco4a1 T C 2: 180,471,237 S421P probably benign Het
Sppl2a A G 2: 126,919,705 L293P probably damaging Het
Sval3 T A 6: 41,972,426 I66K possibly damaging Het
Synj2bp T C 12: 81,504,537 I85V probably benign Het
Thop1 G T 10: 81,080,191 A403S probably benign Het
Timd4 T A 11: 46,815,527 M52K probably damaging Het
Tmco5b A G 2: 113,288,264 N111D probably damaging Het
Trip10 G A 17: 57,261,667 V419I possibly damaging Het
Trpv3 T C 11: 73,286,021 Y409H probably damaging Het
Tulp4 A G 17: 6,233,124 T1143A probably damaging Het
Ugt2b5 A T 5: 87,140,249 S20T probably benign Het
Unc5b A G 10: 60,775,044 F406L probably benign Het
Usp45 A G 4: 21,780,430 D27G probably damaging Het
Vmn2r100 G A 17: 19,522,464 V367I probably benign Het
Vmn2r49 T A 7: 9,976,258 K849I probably damaging Het
Zfp119b A T 17: 55,938,682 H501Q probably damaging Het
Zfp462 C A 4: 55,016,958 H893N probably benign Het
Zkscan4 A G 13: 21,479,355 E88G probably damaging Het
Other mutations in Usf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Usf3 APN 16 44212637 splice site probably null
IGL01971:Usf3 APN 16 44217446 unclassified probably null
IGL01982:Usf3 APN 16 44218817 missense possibly damaging 0.89
IGL02124:Usf3 APN 16 44219656 missense possibly damaging 0.82
IGL02309:Usf3 APN 16 44200663 missense probably benign 0.20
IGL02454:Usf3 APN 16 44217182 missense probably damaging 1.00
IGL02526:Usf3 APN 16 44220311 missense possibly damaging 0.89
IGL02671:Usf3 APN 16 44221781 missense probably damaging 1.00
IGL02800:Usf3 APN 16 44219096 missense probably benign 0.00
IGL02899:Usf3 APN 16 44221226 missense probably damaging 1.00
IGL03223:Usf3 APN 16 44216450 missense probably damaging 1.00
I1329:Usf3 UTSW 16 44220530 missense probably damaging 1.00
R0208:Usf3 UTSW 16 44216906 missense probably damaging 0.98
R0900:Usf3 UTSW 16 44215958 missense probably benign
R1160:Usf3 UTSW 16 44218547 missense probably damaging 1.00
R1417:Usf3 UTSW 16 44217449 missense probably benign 0.00
R1512:Usf3 UTSW 16 44221198 missense probably damaging 1.00
R1603:Usf3 UTSW 16 44218172 missense probably benign
R1702:Usf3 UTSW 16 44219632 nonsense probably null
R1774:Usf3 UTSW 16 44215670 missense probably damaging 1.00
R2344:Usf3 UTSW 16 44216051 missense probably benign
R2400:Usf3 UTSW 16 44215747 missense probably benign 0.04
R2484:Usf3 UTSW 16 44220682 missense probably damaging 0.99
R2570:Usf3 UTSW 16 44216381 missense probably benign 0.00
R3730:Usf3 UTSW 16 44218575 missense probably benign 0.00
R4024:Usf3 UTSW 16 44216165 missense possibly damaging 0.76
R4451:Usf3 UTSW 16 44217888 missense possibly damaging 0.76
R4883:Usf3 UTSW 16 44219579 missense probably damaging 1.00
R4895:Usf3 UTSW 16 44221096 missense possibly damaging 0.93
R4924:Usf3 UTSW 16 44217355 missense probably benign
R5020:Usf3 UTSW 16 44215526 missense probably damaging 1.00
R5034:Usf3 UTSW 16 44216399 missense probably damaging 1.00
R5053:Usf3 UTSW 16 44217187 missense probably benign 0.01
R5058:Usf3 UTSW 16 44212707 missense probably damaging 1.00
R5164:Usf3 UTSW 16 44218180 missense probably damaging 1.00
R5391:Usf3 UTSW 16 44217463 missense probably benign 0.01
R5407:Usf3 UTSW 16 44217406 missense probably benign 0.01
R5536:Usf3 UTSW 16 44217370 missense probably benign 0.16
R5805:Usf3 UTSW 16 44220746 missense possibly damaging 0.50
R5966:Usf3 UTSW 16 44220859 missense probably benign 0.14
R6024:Usf3 UTSW 16 44219840 missense probably damaging 1.00
R6122:Usf3 UTSW 16 44217307 missense probably damaging 0.99
R6180:Usf3 UTSW 16 44221105 missense probably damaging 1.00
R6362:Usf3 UTSW 16 44218577 missense probably benign 0.01
R6579:Usf3 UTSW 16 44218834 missense possibly damaging 0.54
R6874:Usf3 UTSW 16 44219740 missense probably benign 0.00
R7226:Usf3 UTSW 16 44220005 missense possibly damaging 0.54
R7379:Usf3 UTSW 16 44220576 missense probably benign 0.33
R7389:Usf3 UTSW 16 44217941 missense probably benign 0.09
R7452:Usf3 UTSW 16 44220034 missense probably benign 0.00
R7606:Usf3 UTSW 16 44218943 missense probably damaging 1.00
R7765:Usf3 UTSW 16 44219063 missense probably benign 0.28
R7830:Usf3 UTSW 16 44219779 nonsense probably null
R7895:Usf3 UTSW 16 44216202 missense possibly damaging 0.67
R7978:Usf3 UTSW 16 44216202 missense possibly damaging 0.67
X0057:Usf3 UTSW 16 44220784 missense probably benign 0.32
X0066:Usf3 UTSW 16 44220427 missense probably benign 0.00
Z1176:Usf3 UTSW 16 44220431 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATTCAAACCAGGTGGAGCCAG -3'
(R):5'- TCTCCTGATATGAACACTTTCACG -3'

Sequencing Primer
(F):5'- CAGCCCCAGAGTAATTTTGAAG -3'
(R):5'- TCACGAGTTGGGGGACAATTATACTC -3'
Posted On2019-11-26