Incidental Mutation 'R7751:Adgrl4'
ID597210
Institutional Source Beutler Lab
Gene Symbol Adgrl4
Ensembl Gene ENSMUSG00000039167
Gene Nameadhesion G protein-coupled receptor L4
SynonymsEltd1, Etl, EGF-TM7 receptor, 1110033N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7751 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location151437887-151545086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 151492309 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 69 (G69S)
Ref Sequence ENSEMBL: ENSMUSP00000041939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046977] [ENSMUST00000196970]
Predicted Effect probably damaging
Transcript: ENSMUST00000046977
AA Change: G69S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041939
Gene: ENSMUSG00000039167
AA Change: G69S

DomainStartEndE-ValueType
EGF 21 57 9.13e0 SMART
EGF_CA 58 107 4.88e-9 SMART
EGF_CA 108 157 4.88e-9 SMART
Pfam:GAIN 182 390 6.8e-38 PFAM
GPS 414 467 1.25e-17 SMART
Pfam:7tm_2 473 709 2.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196970
SMART Domains Protein: ENSMUSP00000143744
Gene: ENSMUSG00000039167

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 21 57 4.5e-2 SMART
EGF_CA 58 107 2.5e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: For a targeted mutation, no significant differences were detected between homozygous mice and controls in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,383,773 L79H probably damaging Het
2810474O19Rik A G 6: 149,325,438 probably benign Het
Abca15 A T 7: 120,365,821 I769F possibly damaging Het
Ackr1 A C 1: 173,332,212 W247G probably damaging Het
Agrn C T 4: 156,176,429 S710N probably damaging Het
Aox3 A G 1: 58,179,335 M1103V probably benign Het
Asb18 G A 1: 89,968,484 A278V probably benign Het
B3gat2 A G 1: 23,762,864 E77G probably benign Het
C87499 T C 4: 88,629,119 D192G probably benign Het
Camta1 T C 4: 151,148,406 probably null Het
Cbll1 A T 12: 31,487,580 I392N probably damaging Het
Ccdc113 A G 8: 95,538,201 D113G possibly damaging Het
Cd79a T C 7: 24,899,667 F148L probably benign Het
Chad T A 11: 94,565,173 C26S probably damaging Het
Cog4 T C 8: 110,880,968 F696L probably damaging Het
Csf2rb T G 15: 78,341,639 S303R probably damaging Het
Cubn C T 2: 13,360,365 G1621R probably damaging Het
Dennd4c T A 4: 86,828,942 N1454K probably benign Het
Dennd5b T C 6: 149,017,106 I853V probably benign Het
Dopey1 A T 9: 86,507,730 D561V probably benign Het
Dpysl4 A G 7: 139,089,540 I45V probably benign Het
Ect2l A C 10: 18,169,405 S301A possibly damaging Het
Elf2 A G 3: 51,257,614 V323A probably damaging Het
Epcam C T 17: 87,640,476 R125* probably null Het
Ephb4 T C 5: 137,365,675 V612A probably damaging Het
Erich3 C T 3: 154,763,789 R1293C unknown Het
F830045P16Rik C A 2: 129,460,447 L408F probably damaging Het
Fam198a G A 9: 121,964,821 V14I probably benign Het
Gm13102 T C 4: 144,109,217 I485T probably benign Het
Gm14548 T A 7: 3,895,604 I282F probably damaging Het
Gm16494 A T 17: 47,016,874 L28* probably null Het
Grin2c A G 11: 115,253,870 V610A probably damaging Het
Hacd2 T A 16: 35,102,064 Y208N probably damaging Het
Hlf A T 11: 90,387,995 F81Y probably damaging Het
Igfbp7 G A 5: 77,351,287 A257V probably damaging Het
Il12a A T 3: 68,697,902 N167I probably damaging Het
Il1r2 G A 1: 40,123,211 C338Y probably damaging Het
Irf2bpl G T 12: 86,883,715 H61Q probably damaging Het
Kansl1 A G 11: 104,424,064 F383L probably benign Het
Kcnh8 A G 17: 52,961,843 T863A probably damaging Het
Klhl36 C A 8: 119,869,658 Q33K probably benign Het
Lrig2 A T 3: 104,494,669 Y113* probably null Het
Lrrc36 T A 8: 105,452,035 S287R possibly damaging Het
Lrrc6 T C 15: 66,449,563 E243G probably benign Het
Mr1 A T 1: 155,129,308 Y329N probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nectin4 G A 1: 171,383,758 probably null Het
Nsrp1 A G 11: 77,049,271 probably null Het
Olfr1012 A G 2: 85,753,492 T44A probably benign Het
Olfr380 A T 11: 73,453,546 I222N possibly damaging Het
Pcdh8 A T 14: 79,770,703 I140N probably damaging Het
Pdzd8 A G 19: 59,344,776 V271A probably damaging Het
Pex3 T A 10: 13,527,806 I324L possibly damaging Het
Pitpnm1 T A 19: 4,103,470 F209I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1 T A 1: 20,200,925 T3135S probably damaging Het
Prdm16 T C 4: 154,328,299 N1082S probably damaging Het
Psmd12 A T 11: 107,479,613 I13F possibly damaging Het
Ptgs2 A T 1: 150,104,507 I399F probably benign Het
Rasa3 A T 8: 13,568,708 S830T probably benign Het
Rasgef1c A T 11: 49,970,293 R362W probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf217 C A 10: 31,517,419 G389W probably damaging Het
Sec16b A T 1: 157,558,060 D675V probably damaging Het
Serpinb12 A G 1: 106,949,671 Y137C probably damaging Het
Slc2a5 T A 4: 150,143,134 I470N probably damaging Het
Slc5a1 T C 5: 33,133,417 I115T possibly damaging Het
Slco1a4 A T 6: 141,834,687 S126T possibly damaging Het
St6galnac2 T C 11: 116,677,584 D351G probably damaging Het
Stat4 G A 1: 52,082,552 V357M possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tdrd9 T A 12: 111,992,548 C139S probably benign Het
Tmed9 G A 13: 55,593,241 R23Q not run Het
Tmem150a A C 6: 72,359,045 H205P probably damaging Het
Tns2 C A 15: 102,109,728 L350I probably benign Het
Tpr A G 1: 150,419,895 T964A probably benign Het
Traf3ip1 G T 1: 91,494,757 probably benign Het
Trem2 G T 17: 48,346,539 probably benign Het
Ttc14 G A 3: 33,809,441 G666D unknown Het
Ulk1 T C 5: 110,809,212 D40G probably damaging Het
Vmn1r30 A G 6: 58,435,412 V145A probably benign Het
Vmn1r79 C T 7: 12,176,835 Q215* probably null Het
Wnk2 G A 13: 49,078,017 T16I unknown Het
Yme1l1 T C 2: 23,187,844 probably null Het
Zbtb16 T A 9: 48,743,469 H454L probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zrsr1 A G 11: 22,973,595 Q123R possibly damaging Het
Other mutations in Adgrl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Adgrl4 APN 3 151542841 missense probably damaging 1.00
IGL00694:Adgrl4 APN 3 151439396 splice site probably benign
IGL01143:Adgrl4 APN 3 151500229 splice site probably null
IGL01359:Adgrl4 APN 3 151543286 missense probably damaging 1.00
IGL01947:Adgrl4 APN 3 151510791 critical splice donor site probably null
IGL02149:Adgrl4 APN 3 151500354 missense possibly damaging 0.95
IGL02324:Adgrl4 APN 3 151497874 missense probably damaging 1.00
IGL02562:Adgrl4 APN 3 151439312 missense probably damaging 1.00
IGL02644:Adgrl4 APN 3 151492370 missense probably benign 0.00
trivial UTSW 3 151517610 missense probably benign 0.07
R0077:Adgrl4 UTSW 3 151517781 missense probably damaging 1.00
R0116:Adgrl4 UTSW 3 151517610 missense probably benign 0.07
R0331:Adgrl4 UTSW 3 151497940 missense probably benign 0.00
R0601:Adgrl4 UTSW 3 151498429 splice site probably benign
R0613:Adgrl4 UTSW 3 151543222 splice site probably benign
R1293:Adgrl4 UTSW 3 151507444 missense probably benign 0.00
R1463:Adgrl4 UTSW 3 151510596 missense probably damaging 0.98
R1697:Adgrl4 UTSW 3 151517611 missense probably damaging 1.00
R1731:Adgrl4 UTSW 3 151540986 missense possibly damaging 0.64
R1765:Adgrl4 UTSW 3 151543235 missense probably damaging 1.00
R1782:Adgrl4 UTSW 3 151542805 nonsense probably null
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1957:Adgrl4 UTSW 3 151510779 missense possibly damaging 0.94
R2128:Adgrl4 UTSW 3 151500201 missense probably benign 0.00
R2180:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2238:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2474:Adgrl4 UTSW 3 151542724 missense probably benign 0.01
R2697:Adgrl4 UTSW 3 151510623 missense probably damaging 1.00
R3835:Adgrl4 UTSW 3 151510617 missense probably damaging 1.00
R4499:Adgrl4 UTSW 3 151510785 missense possibly damaging 0.81
R4640:Adgrl4 UTSW 3 151500310 unclassified probably benign
R4747:Adgrl4 UTSW 3 151507440 missense probably benign 0.01
R5428:Adgrl4 UTSW 3 151542686 missense probably damaging 1.00
R5510:Adgrl4 UTSW 3 151497830 missense possibly damaging 0.89
R5717:Adgrl4 UTSW 3 151492334 missense probably benign 0.01
R6106:Adgrl4 UTSW 3 151540985 missense possibly damaging 0.67
R6343:Adgrl4 UTSW 3 151517806 missense probably damaging 1.00
R6419:Adgrl4 UTSW 3 151439316 missense probably damaging 1.00
R6468:Adgrl4 UTSW 3 151492375 missense probably benign
R6636:Adgrl4 UTSW 3 151517773 nonsense probably null
R6637:Adgrl4 UTSW 3 151517773 nonsense probably null
R6687:Adgrl4 UTSW 3 151542755 missense probably benign 0.00
R6856:Adgrl4 UTSW 3 151500118 missense probably benign 0.00
R6887:Adgrl4 UTSW 3 151542733 missense possibly damaging 0.46
R7041:Adgrl4 UTSW 3 151439322 missense probably benign 0.00
R7527:Adgrl4 UTSW 3 151439250 missense probably benign 0.08
R7597:Adgrl4 UTSW 3 151543258 missense probably damaging 1.00
X0053:Adgrl4 UTSW 3 151497833 missense probably damaging 1.00
Z1088:Adgrl4 UTSW 3 151500175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCATCTGGGAGGACATAG -3'
(R):5'- CTCATTGATACTCTACAAACATGCC -3'

Sequencing Primer
(F):5'- GTGCCCATGAACTCACAGAAGTTTG -3'
(R):5'- AACTGTGACTTCCCCGTA -3'
Posted On2019-11-26