Incidental Mutation 'R0632:Ctsh'
ID59722
Institutional Source Beutler Lab
Gene Symbol Ctsh
Ensembl Gene ENSMUSG00000032359
Gene Namecathepsin H
SynonymsCat H
MMRRC Submission 038821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0632 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location90054152-90076089 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90061582 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 87 (R87G)
Ref Sequence ENSEMBL: ENSMUSP00000117599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034915] [ENSMUST00000123320] [ENSMUST00000132718] [ENSMUST00000143172] [ENSMUST00000185459]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034915
AA Change: R61G

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034915
Gene: ENSMUSG00000032359
AA Change: R61G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 33 88 7.24e-17 SMART
Pept_C1 114 330 7.46e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127842
Predicted Effect possibly damaging
Transcript: ENSMUST00000132718
AA Change: R87G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117599
Gene: ENSMUSG00000032359
AA Change: R87G

DomainStartEndE-ValueType
Inhibitor_I29 59 114 7.24e-17 SMART
Pfam:Peptidase_C1 140 198 4.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142750
Predicted Effect probably benign
Transcript: ENSMUST00000143172
SMART Domains Protein: ENSMUSP00000114427
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1cs8a_ 62 118 3e-6 SMART
Blast:Pept_C1 63 119 3e-24 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000185459
AA Change: R58G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140437
Gene: ENSMUSG00000032359
AA Change: R58G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Inhibitor_I29 30 85 5.3e-21 SMART
Pept_C1 85 291 9.4e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190338
Meta Mutation Damage Score 0.0973 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin H mini, heavy, and light chains. In rat and human, these three chains can associate to form the mature enzyme, which has both aminopeptidase and endopeptidase activities. Homozygous knockout mice for this gene exhibit impaired lung surfactant processing and reduced tumorigenesis in a pancreatic cancer model. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit impaired lung surfactant and an abnormal eye globe with elongated axial length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Akap6 A T 12: 52,937,148 N825I probably damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Art5 G A 7: 102,097,957 T205I probably damaging Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
C8a T C 4: 104,856,492 D147G probably damaging Het
Ccdc109b T C 3: 129,918,726 M167V probably benign Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cfap54 C T 10: 92,885,096 E2543K unknown Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hist1h4i G T 13: 22,041,027 Y99* probably null Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Klk1b9 G T 7: 43,979,372 G100V possibly damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr652 A G 7: 104,564,337 I39V probably benign Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Vsig10l T G 7: 43,464,137 V171G probably damaging Het
Zfp957 T A 14: 79,212,920 I480F probably damaging Het
Other mutations in Ctsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Ctsh APN 9 90064238 missense probably damaging 1.00
IGL01875:Ctsh APN 9 90064207 missense probably damaging 1.00
IGL02008:Ctsh APN 9 90061547 missense probably damaging 1.00
R0336:Ctsh UTSW 9 90075738 missense probably damaging 1.00
R1488:Ctsh UTSW 9 90071891 missense possibly damaging 0.89
R1847:Ctsh UTSW 9 90061565 missense probably benign 0.04
R3613:Ctsh UTSW 9 90075710 missense probably damaging 1.00
R4270:Ctsh UTSW 9 90061598 missense probably damaging 0.99
R4860:Ctsh UTSW 9 90054548 missense probably benign 0.01
R5187:Ctsh UTSW 9 90054590 missense probably damaging 1.00
R5469:Ctsh UTSW 9 90060511 critical splice donor site probably null
R5900:Ctsh UTSW 9 90064568 missense probably damaging 1.00
R5937:Ctsh UTSW 9 90061456 missense probably benign
R6303:Ctsh UTSW 9 90062743 missense possibly damaging 0.83
R6657:Ctsh UTSW 9 90060502 missense probably benign 0.30
R6905:Ctsh UTSW 9 90062766 missense probably damaging 1.00
R6985:Ctsh UTSW 9 90054604 missense possibly damaging 0.90
R7171:Ctsh UTSW 9 90067101 missense probably benign
R7342:Ctsh UTSW 9 90074987 missense probably benign
R7819:Ctsh UTSW 9 90060503 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTGTGGGCTTCATTCTAGCCACAG -3'
(R):5'- TCCCCAAAGACATCCCTGATTCTGAG -3'

Sequencing Primer
(F):5'- gggaggtagaggtaggatagg -3'
(R):5'- GACATCCCTGATTCTGAGTCTCTG -3'
Posted On2013-07-11