Incidental Mutation 'R7751:Dennd5b'
ID597226
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene NameDENN/MADD domain containing 5B
Synonyms9330160C06Rik, D030011O10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7751 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location148988071-149101680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149017106 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 853 (I853V)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
Predicted Effect probably benign
Transcript: ENSMUST00000111557
AA Change: I853V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: I853V

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,383,773 L79H probably damaging Het
2810474O19Rik A G 6: 149,325,438 probably benign Het
Abca15 A T 7: 120,365,821 I769F possibly damaging Het
Ackr1 A C 1: 173,332,212 W247G probably damaging Het
Adgrl4 G A 3: 151,492,309 G69S probably damaging Het
Agrn C T 4: 156,176,429 S710N probably damaging Het
Aox3 A G 1: 58,179,335 M1103V probably benign Het
Asb18 G A 1: 89,968,484 A278V probably benign Het
B3gat2 A G 1: 23,762,864 E77G probably benign Het
C87499 T C 4: 88,629,119 D192G probably benign Het
Camta1 T C 4: 151,148,406 probably null Het
Cbll1 A T 12: 31,487,580 I392N probably damaging Het
Ccdc113 A G 8: 95,538,201 D113G possibly damaging Het
Cd79a T C 7: 24,899,667 F148L probably benign Het
Chad T A 11: 94,565,173 C26S probably damaging Het
Cog4 T C 8: 110,880,968 F696L probably damaging Het
Csf2rb T G 15: 78,341,639 S303R probably damaging Het
Cubn C T 2: 13,360,365 G1621R probably damaging Het
Dennd4c T A 4: 86,828,942 N1454K probably benign Het
Dopey1 A T 9: 86,507,730 D561V probably benign Het
Dpysl4 A G 7: 139,089,540 I45V probably benign Het
Ect2l A C 10: 18,169,405 S301A possibly damaging Het
Elf2 A G 3: 51,257,614 V323A probably damaging Het
Epcam C T 17: 87,640,476 R125* probably null Het
Ephb4 T C 5: 137,365,675 V612A probably damaging Het
Erich3 C T 3: 154,763,789 R1293C unknown Het
F830045P16Rik C A 2: 129,460,447 L408F probably damaging Het
Fam198a G A 9: 121,964,821 V14I probably benign Het
Gm13102 T C 4: 144,109,217 I485T probably benign Het
Gm14548 T A 7: 3,895,604 I282F probably damaging Het
Gm16494 A T 17: 47,016,874 L28* probably null Het
Grin2c A G 11: 115,253,870 V610A probably damaging Het
Hacd2 T A 16: 35,102,064 Y208N probably damaging Het
Hlf A T 11: 90,387,995 F81Y probably damaging Het
Igfbp7 G A 5: 77,351,287 A257V probably damaging Het
Il12a A T 3: 68,697,902 N167I probably damaging Het
Il1r2 G A 1: 40,123,211 C338Y probably damaging Het
Irf2bpl G T 12: 86,883,715 H61Q probably damaging Het
Kansl1 A G 11: 104,424,064 F383L probably benign Het
Kcnh8 A G 17: 52,961,843 T863A probably damaging Het
Klhl36 C A 8: 119,869,658 Q33K probably benign Het
Lrig2 A T 3: 104,494,669 Y113* probably null Het
Lrrc36 T A 8: 105,452,035 S287R possibly damaging Het
Lrrc6 T C 15: 66,449,563 E243G probably benign Het
Mr1 A T 1: 155,129,308 Y329N probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nectin4 G A 1: 171,383,758 probably null Het
Nsrp1 A G 11: 77,049,271 probably null Het
Olfr1012 A G 2: 85,753,492 T44A probably benign Het
Olfr380 A T 11: 73,453,546 I222N possibly damaging Het
Pcdh8 A T 14: 79,770,703 I140N probably damaging Het
Pdzd8 A G 19: 59,344,776 V271A probably damaging Het
Pex3 T A 10: 13,527,806 I324L possibly damaging Het
Pitpnm1 T A 19: 4,103,470 F209I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1 T A 1: 20,200,925 T3135S probably damaging Het
Prdm16 T C 4: 154,328,299 N1082S probably damaging Het
Psmd12 A T 11: 107,479,613 I13F possibly damaging Het
Ptgs2 A T 1: 150,104,507 I399F probably benign Het
Rasa3 A T 8: 13,568,708 S830T probably benign Het
Rasgef1c A T 11: 49,970,293 R362W probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf217 C A 10: 31,517,419 G389W probably damaging Het
Sec16b A T 1: 157,558,060 D675V probably damaging Het
Serpinb12 A G 1: 106,949,671 Y137C probably damaging Het
Slc2a5 T A 4: 150,143,134 I470N probably damaging Het
Slc5a1 T C 5: 33,133,417 I115T possibly damaging Het
Slco1a4 A T 6: 141,834,687 S126T possibly damaging Het
St6galnac2 T C 11: 116,677,584 D351G probably damaging Het
Stat4 G A 1: 52,082,552 V357M possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tdrd9 T A 12: 111,992,548 C139S probably benign Het
Tmed9 G A 13: 55,593,241 R23Q not run Het
Tmem150a A C 6: 72,359,045 H205P probably damaging Het
Tns2 C A 15: 102,109,728 L350I probably benign Het
Tpr A G 1: 150,419,895 T964A probably benign Het
Traf3ip1 G T 1: 91,494,757 probably benign Het
Trem2 G T 17: 48,346,539 probably benign Het
Ttc14 G A 3: 33,809,441 G666D unknown Het
Ulk1 T C 5: 110,809,212 D40G probably damaging Het
Vmn1r30 A G 6: 58,435,412 V145A probably benign Het
Vmn1r79 C T 7: 12,176,835 Q215* probably null Het
Wnk2 G A 13: 49,078,017 T16I unknown Het
Yme1l1 T C 2: 23,187,844 probably null Het
Zbtb16 T A 9: 48,743,469 H454L probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zrsr1 A G 11: 22,973,595 Q123R possibly damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 149027330 missense probably damaging 1.00
IGL00590:Dennd5b APN 6 149068308 missense probably benign 0.03
IGL00727:Dennd5b APN 6 149006716 splice site probably benign
IGL00838:Dennd5b APN 6 149005363 splice site probably benign
IGL01115:Dennd5b APN 6 149009748 splice site probably benign
IGL01150:Dennd5b APN 6 149068085 missense probably benign 0.01
IGL01873:Dennd5b APN 6 149044529 missense probably benign
IGL01991:Dennd5b APN 6 149080824 missense probably damaging 1.00
IGL02226:Dennd5b APN 6 149033301 missense probably benign 0.00
IGL02820:Dennd5b APN 6 149019342 missense probably null 0.51
IGL03056:Dennd5b APN 6 149055072 missense probably damaging 1.00
IGL03085:Dennd5b APN 6 149027395 missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148998260 missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148993759 missense probably benign 0.13
R0617:Dennd5b UTSW 6 149033262 splice site probably benign
R1241:Dennd5b UTSW 6 149068490 missense probably benign 0.06
R1252:Dennd5b UTSW 6 149044487 missense probably damaging 1.00
R1255:Dennd5b UTSW 6 149041650 missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 149068205 missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148998284 missense probably damaging 1.00
R1781:Dennd5b UTSW 6 149027398 missense probably damaging 1.00
R1861:Dennd5b UTSW 6 149068262 missense probably damaging 1.00
R1907:Dennd5b UTSW 6 149041576 missense probably benign 0.00
R2412:Dennd5b UTSW 6 149005238 missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149101217 missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 149044836 missense probably benign
R4581:Dennd5b UTSW 6 149016984 splice site silent
R4654:Dennd5b UTSW 6 149006837 missense probably damaging 1.00
R4725:Dennd5b UTSW 6 149044779 missense probably damaging 0.97
R4981:Dennd5b UTSW 6 149009772 missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 149041500 splice site probably null
R5400:Dennd5b UTSW 6 149000016 missense probably damaging 1.00
R5452:Dennd5b UTSW 6 149041513 splice site probably null
R5548:Dennd5b UTSW 6 149019349 splice site probably null
R5841:Dennd5b UTSW 6 149044755 missense probably benign 0.11
R5996:Dennd5b UTSW 6 149068095 missense probably benign 0.22
R6082:Dennd5b UTSW 6 149068695 missense probably damaging 0.99
R6556:Dennd5b UTSW 6 149014251 splice site probably null
R6812:Dennd5b UTSW 6 149081132 start gained probably benign
R6828:Dennd5b UTSW 6 148993746 missense probably damaging 0.99
R7104:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7231:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7325:Dennd5b UTSW 6 149020570 missense probably benign 0.00
R7399:Dennd5b UTSW 6 149036483 missense probably damaging 1.00
R7516:Dennd5b UTSW 6 149068380 missense probably benign 0.02
R7763:Dennd5b UTSW 6 149068658 missense probably damaging 1.00
R7770:Dennd5b UTSW 6 149041716 missense probably damaging 0.99
R7788:Dennd5b UTSW 6 149068566 missense probably benign 0.00
R7854:Dennd5b UTSW 6 149068466 missense probably benign 0.00
R7899:Dennd5b UTSW 6 149041661 missense probably damaging 1.00
R8226:Dennd5b UTSW 6 149014248 splice site probably null
R8328:Dennd5b UTSW 6 149020617 missense probably damaging 1.00
R8517:Dennd5b UTSW 6 149029121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTGTCAGCTTACTCAATTTCC -3'
(R):5'- TGGATGCTGCTTGTCATCCATG -3'

Sequencing Primer
(F):5'- CCTTTGTATGCACAAGTCACAG -3'
(R):5'- GCTTGTCATCCATGCAACAG -3'
Posted On2019-11-26