Incidental Mutation 'R7751:Dennd5b'
ID 597226
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 045807-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R7751 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148918604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 853 (I853V)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably benign
Transcript: ENSMUST00000111557
AA Change: I853V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: I853V

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,965,044 (GRCm39) I769F possibly damaging Het
Ackr1 A C 1: 173,159,779 (GRCm39) W247G probably damaging Het
Adgrl4 G A 3: 151,197,946 (GRCm39) G69S probably damaging Het
Agrn C T 4: 156,260,886 (GRCm39) S710N probably damaging Het
Aox3 A G 1: 58,218,494 (GRCm39) M1103V probably benign Het
Asb18 G A 1: 89,896,206 (GRCm39) A278V probably benign Het
B3gat2 A G 1: 23,801,945 (GRCm39) E77G probably benign Het
Camta1 T C 4: 151,232,863 (GRCm39) probably null Het
Cbll1 A T 12: 31,537,579 (GRCm39) I392N probably damaging Het
Ccdc113 A G 8: 96,264,829 (GRCm39) D113G possibly damaging Het
Cd79a T C 7: 24,599,092 (GRCm39) F148L probably benign Het
Chad T A 11: 94,455,999 (GRCm39) C26S probably damaging Het
Cog4 T C 8: 111,607,600 (GRCm39) F696L probably damaging Het
Csf2rb T G 15: 78,225,839 (GRCm39) S303R probably damaging Het
Cstpp1 A T 2: 91,214,118 (GRCm39) L79H probably damaging Het
Cubn C T 2: 13,365,176 (GRCm39) G1621R probably damaging Het
Dennd4c T A 4: 86,747,179 (GRCm39) N1454K probably benign Het
Dnaaf11 T C 15: 66,321,412 (GRCm39) E243G probably benign Het
Dop1a A T 9: 86,389,783 (GRCm39) D561V probably benign Het
Dpysl4 A G 7: 138,669,456 (GRCm39) I45V probably benign Het
Ect2l A C 10: 18,045,153 (GRCm39) S301A possibly damaging Het
Elf2 A G 3: 51,165,035 (GRCm39) V323A probably damaging Het
Epcam C T 17: 87,947,904 (GRCm39) R125* probably null Het
Ephb4 T C 5: 137,363,937 (GRCm39) V612A probably damaging Het
Erich3 C T 3: 154,469,426 (GRCm39) R1293C unknown Het
F830045P16Rik C A 2: 129,302,367 (GRCm39) L408F probably damaging Het
Gask1a G A 9: 121,793,887 (GRCm39) V14I probably benign Het
Gm13102 T C 4: 143,835,787 (GRCm39) I485T probably benign Het
Gm16494 A T 17: 47,327,800 (GRCm39) L28* probably null Het
Grin2c A G 11: 115,144,696 (GRCm39) V610A probably damaging Het
Hacd2 T A 16: 34,922,434 (GRCm39) Y208N probably damaging Het
Hlf A T 11: 90,278,821 (GRCm39) F81Y probably damaging Het
Igfbp7 G A 5: 77,499,134 (GRCm39) A257V probably damaging Het
Il12a A T 3: 68,605,235 (GRCm39) N167I probably damaging Het
Il1r2 G A 1: 40,162,371 (GRCm39) C338Y probably damaging Het
Irf2bpl G T 12: 86,930,489 (GRCm39) H61Q probably damaging Het
Kansl1 A G 11: 104,314,890 (GRCm39) F383L probably benign Het
Kcnh8 A G 17: 53,268,871 (GRCm39) T863A probably damaging Het
Klhl36 C A 8: 120,596,397 (GRCm39) Q33K probably benign Het
Lrig2 A T 3: 104,401,985 (GRCm39) Y113* probably null Het
Lrrc36 T A 8: 106,178,667 (GRCm39) S287R possibly damaging Het
Mr1 A T 1: 155,005,054 (GRCm39) Y329N probably damaging Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nectin4 G A 1: 171,211,326 (GRCm39) probably null Het
Nsrp1 A G 11: 76,940,097 (GRCm39) probably null Het
Or1e21 A T 11: 73,344,372 (GRCm39) I222N possibly damaging Het
Or9g3 A G 2: 85,583,836 (GRCm39) T44A probably benign Het
Pcdh8 A T 14: 80,008,143 (GRCm39) I140N probably damaging Het
Pdzd8 A G 19: 59,333,208 (GRCm39) V271A probably damaging Het
Pex3 T A 10: 13,403,550 (GRCm39) I324L possibly damaging Het
Pira12 T A 7: 3,898,603 (GRCm39) I282F probably damaging Het
Pitpnm1 T A 19: 4,153,470 (GRCm39) F209I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pkhd1 T A 1: 20,271,149 (GRCm39) T3135S probably damaging Het
Pramel32 T C 4: 88,547,356 (GRCm39) D192G probably benign Het
Prdm16 T C 4: 154,412,756 (GRCm39) N1082S probably damaging Het
Psmd12 A T 11: 107,370,439 (GRCm39) I13F possibly damaging Het
Ptgs2 A T 1: 149,980,258 (GRCm39) I399F probably benign Het
Rasa3 A T 8: 13,618,708 (GRCm39) S830T probably benign Het
Rasgef1c A T 11: 49,861,120 (GRCm39) R362W probably damaging Het
Resf1 A G 6: 149,226,936 (GRCm39) probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rnf217 C A 10: 31,393,415 (GRCm39) G389W probably damaging Het
Sec16b A T 1: 157,385,630 (GRCm39) D675V probably damaging Het
Serpinb12 A G 1: 106,877,401 (GRCm39) Y137C probably damaging Het
Slc2a5 T A 4: 150,227,591 (GRCm39) I470N probably damaging Het
Slc5a1 T C 5: 33,290,761 (GRCm39) I115T possibly damaging Het
Slco1a4 A T 6: 141,780,413 (GRCm39) S126T possibly damaging Het
St6galnac2 T C 11: 116,568,410 (GRCm39) D351G probably damaging Het
Stat4 G A 1: 52,121,711 (GRCm39) V357M possibly damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tdrd9 T A 12: 111,958,982 (GRCm39) C139S probably benign Het
Tmed9 G A 13: 55,741,054 (GRCm39) R23Q not run Het
Tmem150a A C 6: 72,336,028 (GRCm39) H205P probably damaging Het
Tns2 C A 15: 102,018,163 (GRCm39) L350I probably benign Het
Tpr A G 1: 150,295,646 (GRCm39) T964A probably benign Het
Traf3ip1 G T 1: 91,422,479 (GRCm39) probably benign Het
Trem2 G T 17: 48,653,567 (GRCm39) probably benign Het
Ttc14 G A 3: 33,863,590 (GRCm39) G666D unknown Het
Ulk1 T C 5: 110,957,078 (GRCm39) D40G probably damaging Het
Vmn1r30 A G 6: 58,412,397 (GRCm39) V145A probably benign Het
Vmn1r79 C T 7: 11,910,762 (GRCm39) Q215* probably null Het
Wnk2 G A 13: 49,231,493 (GRCm39) T16I unknown Het
Yme1l1 T C 2: 23,077,856 (GRCm39) probably null Het
Zbtb16 T A 9: 48,654,769 (GRCm39) H454L probably damaging Het
Zkscan5 A C 5: 145,157,676 (GRCm39) H726P probably damaging Het
Zrsr2-ps1 A G 11: 22,923,595 (GRCm39) Q123R possibly damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTGTCAGCTTACTCAATTTCC -3'
(R):5'- TGGATGCTGCTTGTCATCCATG -3'

Sequencing Primer
(F):5'- CCTTTGTATGCACAAGTCACAG -3'
(R):5'- GCTTGTCATCCATGCAACAG -3'
Posted On 2019-11-26