Incidental Mutation 'R7751:Muc5ac'
ID597233
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Namemucin 5, subtypes A and C, tracheobronchial/gastric
SynonymsMGM, 2210005L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7751 (G1)
Quality Score174.009
Status Not validated
Chromosome7
Chromosomal Location141788972-141819231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 141809303 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 2117 (G2117A)
Ref Sequence ENSEMBL: ENSMUSP00000122353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
Predicted Effect probably benign
Transcript: ENSMUST00000041924
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155534
AA Change: G2117A
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: G2117A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163321
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,383,773 L79H probably damaging Het
2810474O19Rik A G 6: 149,325,438 probably benign Het
Abca15 A T 7: 120,365,821 I769F possibly damaging Het
Ackr1 A C 1: 173,332,212 W247G probably damaging Het
Adgrl4 G A 3: 151,492,309 G69S probably damaging Het
Agrn C T 4: 156,176,429 S710N probably damaging Het
Aox3 A G 1: 58,179,335 M1103V probably benign Het
Asb18 G A 1: 89,968,484 A278V probably benign Het
B3gat2 A G 1: 23,762,864 E77G probably benign Het
C87499 T C 4: 88,629,119 D192G probably benign Het
Camta1 T C 4: 151,148,406 probably null Het
Cbll1 A T 12: 31,487,580 I392N probably damaging Het
Ccdc113 A G 8: 95,538,201 D113G possibly damaging Het
Cd79a T C 7: 24,899,667 F148L probably benign Het
Chad T A 11: 94,565,173 C26S probably damaging Het
Cog4 T C 8: 110,880,968 F696L probably damaging Het
Csf2rb T G 15: 78,341,639 S303R probably damaging Het
Cubn C T 2: 13,360,365 G1621R probably damaging Het
Dennd4c T A 4: 86,828,942 N1454K probably benign Het
Dennd5b T C 6: 149,017,106 I853V probably benign Het
Dopey1 A T 9: 86,507,730 D561V probably benign Het
Dpysl4 A G 7: 139,089,540 I45V probably benign Het
Ect2l A C 10: 18,169,405 S301A possibly damaging Het
Elf2 A G 3: 51,257,614 V323A probably damaging Het
Epcam C T 17: 87,640,476 R125* probably null Het
Ephb4 T C 5: 137,365,675 V612A probably damaging Het
Erich3 C T 3: 154,763,789 R1293C unknown Het
F830045P16Rik C A 2: 129,460,447 L408F probably damaging Het
Fam198a G A 9: 121,964,821 V14I probably benign Het
Gm13102 T C 4: 144,109,217 I485T probably benign Het
Gm14548 T A 7: 3,895,604 I282F probably damaging Het
Gm16494 A T 17: 47,016,874 L28* probably null Het
Grin2c A G 11: 115,253,870 V610A probably damaging Het
Hacd2 T A 16: 35,102,064 Y208N probably damaging Het
Hlf A T 11: 90,387,995 F81Y probably damaging Het
Igfbp7 G A 5: 77,351,287 A257V probably damaging Het
Il12a A T 3: 68,697,902 N167I probably damaging Het
Il1r2 G A 1: 40,123,211 C338Y probably damaging Het
Irf2bpl G T 12: 86,883,715 H61Q probably damaging Het
Kansl1 A G 11: 104,424,064 F383L probably benign Het
Kcnh8 A G 17: 52,961,843 T863A probably damaging Het
Klhl36 C A 8: 119,869,658 Q33K probably benign Het
Lrig2 A T 3: 104,494,669 Y113* probably null Het
Lrrc36 T A 8: 105,452,035 S287R possibly damaging Het
Lrrc6 T C 15: 66,449,563 E243G probably benign Het
Mr1 A T 1: 155,129,308 Y329N probably damaging Het
Nectin4 G A 1: 171,383,758 probably null Het
Nsrp1 A G 11: 77,049,271 probably null Het
Olfr1012 A G 2: 85,753,492 T44A probably benign Het
Olfr380 A T 11: 73,453,546 I222N possibly damaging Het
Pcdh8 A T 14: 79,770,703 I140N probably damaging Het
Pdzd8 A G 19: 59,344,776 V271A probably damaging Het
Pex3 T A 10: 13,527,806 I324L possibly damaging Het
Pitpnm1 T A 19: 4,103,470 F209I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1 T A 1: 20,200,925 T3135S probably damaging Het
Prdm16 T C 4: 154,328,299 N1082S probably damaging Het
Psmd12 A T 11: 107,479,613 I13F possibly damaging Het
Ptgs2 A T 1: 150,104,507 I399F probably benign Het
Rasa3 A T 8: 13,568,708 S830T probably benign Het
Rasgef1c A T 11: 49,970,293 R362W probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf217 C A 10: 31,517,419 G389W probably damaging Het
Sec16b A T 1: 157,558,060 D675V probably damaging Het
Serpinb12 A G 1: 106,949,671 Y137C probably damaging Het
Slc2a5 T A 4: 150,143,134 I470N probably damaging Het
Slc5a1 T C 5: 33,133,417 I115T possibly damaging Het
Slco1a4 A T 6: 141,834,687 S126T possibly damaging Het
St6galnac2 T C 11: 116,677,584 D351G probably damaging Het
Stat4 G A 1: 52,082,552 V357M possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tdrd9 T A 12: 111,992,548 C139S probably benign Het
Tmed9 G A 13: 55,593,241 R23Q not run Het
Tmem150a A C 6: 72,359,045 H205P probably damaging Het
Tns2 C A 15: 102,109,728 L350I probably benign Het
Tpr A G 1: 150,419,895 T964A probably benign Het
Traf3ip1 G T 1: 91,494,757 probably benign Het
Trem2 G T 17: 48,346,539 probably benign Het
Ttc14 G A 3: 33,809,441 G666D unknown Het
Ulk1 T C 5: 110,809,212 D40G probably damaging Het
Vmn1r30 A G 6: 58,435,412 V145A probably benign Het
Vmn1r79 C T 7: 12,176,835 Q215* probably null Het
Wnk2 G A 13: 49,078,017 T16I unknown Het
Yme1l1 T C 2: 23,187,844 probably null Het
Zbtb16 T A 9: 48,743,469 H454L probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zrsr1 A G 11: 22,973,595 Q123R possibly damaging Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141812703 missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141807473 missense probably benign 0.12
IGL01155:Muc5ac APN 7 141806943 splice site probably benign
IGL01452:Muc5ac APN 7 141817555 missense probably benign 0.00
IGL01590:Muc5ac APN 7 141798893 missense probably benign 0.02
IGL02104:Muc5ac APN 7 141811078 missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141800177 missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141818800 nonsense probably null
IGL02178:Muc5ac APN 7 141805447 splice site probably benign
IGL02403:Muc5ac APN 7 141803450 missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141817044 missense probably benign 0.01
IGL02665:Muc5ac APN 7 141791086 missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141795263 missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141805775 missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141813781 missense probably benign 0.34
IGL03384:Muc5ac APN 7 141812403 missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141795213 missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141807416 missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141818630 missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141795275 missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141811039 missense probably benign 0.08
R0363:Muc5ac UTSW 7 141800960 missense probably benign 0.01
R0384:Muc5ac UTSW 7 141812251 missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141792034 nonsense probably null
R0583:Muc5ac UTSW 7 141807608 missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141796244 missense probably benign 0.02
R0682:Muc5ac UTSW 7 141805669 missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141807709 missense probably benign 0.03
R0883:Muc5ac UTSW 7 141796265 missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141807515 missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141816929 missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141807323 missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141807377 missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141813892 splice site probably null
R1599:Muc5ac UTSW 7 141798903 missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141801531 missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141807086 missense probably benign 0.00
R1911:Muc5ac UTSW 7 141796304 missense probably benign 0.18
R1922:Muc5ac UTSW 7 141793689 missense probably benign 0.03
R1966:Muc5ac UTSW 7 141803376 missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141813152 missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141792035 missense probably benign 0.01
R2126:Muc5ac UTSW 7 141810742 missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141812347 missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2259:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2293:Muc5ac UTSW 7 141807199 missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141818104 missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141791140 missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141807641 missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141792736 splice site probably null
R3762:Muc5ac UTSW 7 141807475 missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141798501 missense probably benign 0.32
R3806:Muc5ac UTSW 7 141813734 missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141814723 missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141791224 missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141802892 missense probably benign
R3981:Muc5ac UTSW 7 141813775 missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141799844 critical splice donor site probably null
R4043:Muc5ac UTSW 7 141807478 missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141811130 missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141802835 missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141817110 missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141791103 missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141789763 missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141817601 missense probably benign 0.00
R4789:Muc5ac UTSW 7 141798882 missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141817902 nonsense probably null
R4971:Muc5ac UTSW 7 141816278 missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141809456 intron probably benign
R5088:Muc5ac UTSW 7 141796319 missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141814742 missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141793971 missense probably benign 0.32
R5366:Muc5ac UTSW 7 141807550 missense probably benign 0.01
R5497:Muc5ac UTSW 7 141807643 missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141807832 missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141793715 critical splice donor site probably null
R5811:Muc5ac UTSW 7 141798984 missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141817907 missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141790669 nonsense probably null
R5977:Muc5ac UTSW 7 141796367 missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141811857 missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141801232 missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141815586 missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141789795 missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141816864 nonsense probably null
R6341:Muc5ac UTSW 7 141801492 missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141812679 missense probably benign 0.05
R6481:Muc5ac UTSW 7 141809071 intron probably benign
R6483:Muc5ac UTSW 7 141802854 missense probably benign 0.18
R6627:Muc5ac UTSW 7 141808690 intron probably benign
R6636:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141803328 missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141798992 missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141809552 intron probably benign
R6844:Muc5ac UTSW 7 141809744 intron probably benign
R6847:Muc5ac UTSW 7 141809744 intron probably benign
R6852:Muc5ac UTSW 7 141816907 missense probably benign 0.03
R6862:Muc5ac UTSW 7 141809744 intron probably benign
R6863:Muc5ac UTSW 7 141809744 intron probably benign
R6864:Muc5ac UTSW 7 141809744 intron probably benign
R6865:Muc5ac UTSW 7 141809744 intron probably benign
R6874:Muc5ac UTSW 7 141809744 intron probably benign
R6875:Muc5ac UTSW 7 141809744 intron probably benign
R6876:Muc5ac UTSW 7 141809744 intron probably benign
R6877:Muc5ac UTSW 7 141809744 intron probably benign
R6889:Muc5ac UTSW 7 141809744 intron probably benign
R6920:Muc5ac UTSW 7 141793298 missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141818714 missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141809687 intron probably benign
R7091:Muc5ac UTSW 7 141809687 intron probably benign
R7092:Muc5ac UTSW 7 141809648 intron probably benign
R7092:Muc5ac UTSW 7 141809687 intron probably benign
R7110:Muc5ac UTSW 7 141799822 missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141813822 nonsense probably null
R7238:Muc5ac UTSW 7 141809517 missense unknown
R7238:Muc5ac UTSW 7 141809687 intron probably benign
R7396:Muc5ac UTSW 7 141808415 missense unknown
R7456:Muc5ac UTSW 7 141793167 missense probably benign 0.32
R7477:Muc5ac UTSW 7 141816282 missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141813799 missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141808668 missense unknown
R7604:Muc5ac UTSW 7 141809709 missense unknown
R7635:Muc5ac UTSW 7 141805676 missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141805753 missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141809422 missense unknown
R7651:Muc5ac UTSW 7 141796254 missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141809383 missense unknown
R7720:Muc5ac UTSW 7 141809303 missense unknown
R7749:Muc5ac UTSW 7 141809303 missense unknown
R7750:Muc5ac UTSW 7 141809303 missense unknown
R7754:Muc5ac UTSW 7 141809303 missense unknown
R7798:Muc5ac UTSW 7 141794041 critical splice donor site probably null
R7835:Muc5ac UTSW 7 141809303 missense unknown
R7837:Muc5ac UTSW 7 141815963 missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141803429 missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141795852 missense probably benign 0.00
R7874:Muc5ac UTSW 7 141809303 missense unknown
R7876:Muc5ac UTSW 7 141809303 missense unknown
R7877:Muc5ac UTSW 7 141809303 missense unknown
R7881:Muc5ac UTSW 7 141809303 missense unknown
R7884:Muc5ac UTSW 7 141809303 missense unknown
R7921:Muc5ac UTSW 7 141809687 intron probably benign
R7976:Muc5ac UTSW 7 141809791 missense unknown
R8104:Muc5ac UTSW 7 141804783 missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141807331 missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141802948 missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141809263 missense unknown
R8386:Muc5ac UTSW 7 141807634 missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141810476 missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141807155 missense probably damaging 1.00
X0060:Muc5ac UTSW 7 141803333 missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141809744 intron probably benign
Z1088:Muc5ac UTSW 7 141811692 missense possibly damaging 0.86
Z1177:Muc5ac UTSW 7 141809224 missense unknown
Z1177:Muc5ac UTSW 7 141818040 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCACCCAATACAGGAAAGGC -3'
(R):5'- GGTGCTGGCCTTTCCTGTAT -3'

Sequencing Primer
(F):5'- TACAGGAAAGGCCAGCACC -3'
(R):5'- CCTTTCCTGTATTGGGTGAGC -3'
Posted On2019-11-26