Incidental Mutation 'R0632:Acaa1a'
ID 59724
Institutional Source Beutler Lab
Gene Symbol Acaa1a
Ensembl Gene ENSMUSG00000036138
Gene Name acetyl-Coenzyme A acyltransferase 1A
Synonyms Acaa1, D9Ertd25e, peroxisomal 3-ketoacyl-CoA thiolase, thiolase A, PTL
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0632 (G1)
Quality Score 207
Status Validated
Chromosome 9
Chromosomal Location 119170094-119179361 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 119176884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039784] [ENSMUST00000170400] [ENSMUST00000175743] [ENSMUST00000176546] [ENSMUST00000176397] [ENSMUST00000177463]
AlphaFold Q921H8
Predicted Effect probably benign
Transcript: ENSMUST00000039784
SMART Domains Protein: ENSMUSP00000042351
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 3.6e-88 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175719
Predicted Effect probably benign
Transcript: ENSMUST00000175743
SMART Domains Protein: ENSMUSP00000135439
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 291 4.2e-90 PFAM
Pfam:Thiolase_C 298 337 8.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176007
Predicted Effect probably benign
Transcript: ENSMUST00000176546
SMART Domains Protein: ENSMUSP00000134981
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 1 110 4.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176397
SMART Domains Protein: ENSMUSP00000135191
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 152 4.9e-38 PFAM
Pfam:Thiolase_N 148 246 4.8e-34 PFAM
Pfam:Thiolase_C 214 328 5.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176796
Predicted Effect probably benign
Transcript: ENSMUST00000177463
SMART Domains Protein: ENSMUSP00000135310
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 199 3.2e-50 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme operative in the beta-oxidation system of the peroxisomes. Deficiency of this enzyme leads to pseudo-Zellweger syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Acaa1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3418:Acaa1a UTSW 9 119,178,556 (GRCm39) critical splice acceptor site probably null
R4617:Acaa1a UTSW 9 119,178,006 (GRCm39) missense probably damaging 1.00
R4908:Acaa1a UTSW 9 119,177,772 (GRCm39) missense probably benign
R4912:Acaa1a UTSW 9 119,171,827 (GRCm39) missense probably damaging 1.00
R6351:Acaa1a UTSW 9 119,170,630 (GRCm39) nonsense probably null
R6586:Acaa1a UTSW 9 119,178,604 (GRCm39) splice site probably null
R7040:Acaa1a UTSW 9 119,178,104 (GRCm39) missense probably damaging 1.00
R7500:Acaa1a UTSW 9 119,173,564 (GRCm39) missense probably benign 0.00
R8993:Acaa1a UTSW 9 119,178,418 (GRCm39) critical splice acceptor site probably null
R9173:Acaa1a UTSW 9 119,170,190 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGCAAGCACAGTCCTTCAG -3'
(R):5'- GCTTCTCGCATCTTTGCTAAGAGCC -3'

Sequencing Primer
(F):5'- AAGCACAGTCCTTCAGTGTGG -3'
(R):5'- ACTTCTAGCCTGCCCAGAG -3'
Posted On 2013-07-11