Incidental Mutation 'R7751:Zbtb16'
ID597240
Institutional Source Beutler Lab
Gene Symbol Zbtb16
Ensembl Gene ENSMUSG00000066687
Gene Namezinc finger and BTB domain containing 16
SynonymsGreen's luxoid, Zfp145, PLZF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.766) question?
Stock #R7751 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location48654297-48836222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48743469 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 454 (H454L)
Ref Sequence ENSEMBL: ENSMUSP00000091374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]
Predicted Effect probably damaging
Transcript: ENSMUST00000093852
AA Change: H454L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: H454L

DomainStartEndE-ValueType
BTB 34 126 1.41e-24 SMART
ZnF_C2H2 404 426 3.72e0 SMART
ZnF_C2H2 432 454 8.22e-2 SMART
ZnF_C2H2 461 483 2.24e-3 SMART
ZnF_C2H2 490 512 1.56e-2 SMART
ZnF_C2H2 518 540 1.63e-5 SMART
ZnF_C2H2 546 568 1.95e-3 SMART
ZnF_C2H2 574 596 5.9e-3 SMART
ZnF_C2H2 602 624 2.36e-2 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000216150
AA Change: H454L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9597 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,383,773 L79H probably damaging Het
2810474O19Rik A G 6: 149,325,438 probably benign Het
Abca15 A T 7: 120,365,821 I769F possibly damaging Het
Ackr1 A C 1: 173,332,212 W247G probably damaging Het
Adgrl4 G A 3: 151,492,309 G69S probably damaging Het
Agrn C T 4: 156,176,429 S710N probably damaging Het
Aox3 A G 1: 58,179,335 M1103V probably benign Het
Asb18 G A 1: 89,968,484 A278V probably benign Het
B3gat2 A G 1: 23,762,864 E77G probably benign Het
C87499 T C 4: 88,629,119 D192G probably benign Het
Camta1 T C 4: 151,148,406 probably null Het
Cbll1 A T 12: 31,487,580 I392N probably damaging Het
Ccdc113 A G 8: 95,538,201 D113G possibly damaging Het
Cd79a T C 7: 24,899,667 F148L probably benign Het
Chad T A 11: 94,565,173 C26S probably damaging Het
Cog4 T C 8: 110,880,968 F696L probably damaging Het
Csf2rb T G 15: 78,341,639 S303R probably damaging Het
Cubn C T 2: 13,360,365 G1621R probably damaging Het
Dennd4c T A 4: 86,828,942 N1454K probably benign Het
Dennd5b T C 6: 149,017,106 I853V probably benign Het
Dopey1 A T 9: 86,507,730 D561V probably benign Het
Dpysl4 A G 7: 139,089,540 I45V probably benign Het
Ect2l A C 10: 18,169,405 S301A possibly damaging Het
Elf2 A G 3: 51,257,614 V323A probably damaging Het
Epcam C T 17: 87,640,476 R125* probably null Het
Ephb4 T C 5: 137,365,675 V612A probably damaging Het
Erich3 C T 3: 154,763,789 R1293C unknown Het
F830045P16Rik C A 2: 129,460,447 L408F probably damaging Het
Fam198a G A 9: 121,964,821 V14I probably benign Het
Gm13102 T C 4: 144,109,217 I485T probably benign Het
Gm14548 T A 7: 3,895,604 I282F probably damaging Het
Gm16494 A T 17: 47,016,874 L28* probably null Het
Grin2c A G 11: 115,253,870 V610A probably damaging Het
Hacd2 T A 16: 35,102,064 Y208N probably damaging Het
Hlf A T 11: 90,387,995 F81Y probably damaging Het
Igfbp7 G A 5: 77,351,287 A257V probably damaging Het
Il12a A T 3: 68,697,902 N167I probably damaging Het
Il1r2 G A 1: 40,123,211 C338Y probably damaging Het
Irf2bpl G T 12: 86,883,715 H61Q probably damaging Het
Kansl1 A G 11: 104,424,064 F383L probably benign Het
Kcnh8 A G 17: 52,961,843 T863A probably damaging Het
Klhl36 C A 8: 119,869,658 Q33K probably benign Het
Lrig2 A T 3: 104,494,669 Y113* probably null Het
Lrrc36 T A 8: 105,452,035 S287R possibly damaging Het
Lrrc6 T C 15: 66,449,563 E243G probably benign Het
Mr1 A T 1: 155,129,308 Y329N probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nectin4 G A 1: 171,383,758 probably null Het
Nsrp1 A G 11: 77,049,271 probably null Het
Olfr1012 A G 2: 85,753,492 T44A probably benign Het
Olfr380 A T 11: 73,453,546 I222N possibly damaging Het
Pcdh8 A T 14: 79,770,703 I140N probably damaging Het
Pdzd8 A G 19: 59,344,776 V271A probably damaging Het
Pex3 T A 10: 13,527,806 I324L possibly damaging Het
Pitpnm1 T A 19: 4,103,470 F209I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1 T A 1: 20,200,925 T3135S probably damaging Het
Prdm16 T C 4: 154,328,299 N1082S probably damaging Het
Psmd12 A T 11: 107,479,613 I13F possibly damaging Het
Ptgs2 A T 1: 150,104,507 I399F probably benign Het
Rasa3 A T 8: 13,568,708 S830T probably benign Het
Rasgef1c A T 11: 49,970,293 R362W probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf217 C A 10: 31,517,419 G389W probably damaging Het
Sec16b A T 1: 157,558,060 D675V probably damaging Het
Serpinb12 A G 1: 106,949,671 Y137C probably damaging Het
Slc2a5 T A 4: 150,143,134 I470N probably damaging Het
Slc5a1 T C 5: 33,133,417 I115T possibly damaging Het
Slco1a4 A T 6: 141,834,687 S126T possibly damaging Het
St6galnac2 T C 11: 116,677,584 D351G probably damaging Het
Stat4 G A 1: 52,082,552 V357M possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tdrd9 T A 12: 111,992,548 C139S probably benign Het
Tmed9 G A 13: 55,593,241 R23Q not run Het
Tmem150a A C 6: 72,359,045 H205P probably damaging Het
Tns2 C A 15: 102,109,728 L350I probably benign Het
Tpr A G 1: 150,419,895 T964A probably benign Het
Traf3ip1 G T 1: 91,494,757 probably benign Het
Trem2 G T 17: 48,346,539 probably benign Het
Ttc14 G A 3: 33,809,441 G666D unknown Het
Ulk1 T C 5: 110,809,212 D40G probably damaging Het
Vmn1r30 A G 6: 58,435,412 V145A probably benign Het
Vmn1r79 C T 7: 12,176,835 Q215* probably null Het
Wnk2 G A 13: 49,078,017 T16I unknown Het
Yme1l1 T C 2: 23,187,844 probably null Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zrsr1 A G 11: 22,973,595 Q123R possibly damaging Het
Other mutations in Zbtb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Zbtb16 APN 9 48657183 missense probably damaging 1.00
R0324:Zbtb16 UTSW 9 48665275 missense possibly damaging 0.82
R0364:Zbtb16 UTSW 9 48743576 splice site probably benign
R1538:Zbtb16 UTSW 9 48832283 missense probably benign
R1575:Zbtb16 UTSW 9 48832272 missense probably damaging 0.96
R1937:Zbtb16 UTSW 9 48659778 missense probably benign
R2656:Zbtb16 UTSW 9 48832688 missense probably damaging 1.00
R4176:Zbtb16 UTSW 9 48659801 missense probably damaging 1.00
R4582:Zbtb16 UTSW 9 48832082 missense probably benign
R4595:Zbtb16 UTSW 9 48832080 missense possibly damaging 0.79
R6466:Zbtb16 UTSW 9 48665319 missense possibly damaging 0.95
R6966:Zbtb16 UTSW 9 48657354 missense probably damaging 1.00
R7596:Zbtb16 UTSW 9 48832404 missense possibly damaging 0.93
R7904:Zbtb16 UTSW 9 48832972 missense probably damaging 1.00
Z1176:Zbtb16 UTSW 9 48657288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGTTCCTCTGATGGGCAC -3'
(R):5'- GGAGATTACTCTGAAAGCCTGTAG -3'

Sequencing Primer
(F):5'- GTGAAGACAACTAGACCAGG -3'
(R):5'- CCTGTAGGCGTGTGTGTG -3'
Posted On2019-11-26