Mutagenetix > Incidental Mutation

Incidental Mutation 'R7751:Zbtb16'

597240

Institutional Source

Beutler Lab

Gene Symbol

Zbtb16

Ensembl Gene

ENSMUSG00000066687

Gene Name

zinc finger and BTB domain containing 16

Synonyms

Green's luxoid, Zfp145, PLZF

MMRRC Submission

045807-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.799) question?

Stock #

R7751 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48654297-48836222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 48743469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 454 (H454L)

Ref Sequence

ENSEMBL: ENSMUSP00000091374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]

AlphaFold

Q3UQ17

Predicted Effect

probably damaging
Transcript: ENSMUST00000093852
AA Change: H454L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: H454L

Domain	Start	End	E-Value	Type
BTB	34	126	1.41e-24	SMART
ZnF_C2H2	404	426	3.72e0	SMART
ZnF_C2H2	432	454	8.22e-2	SMART
ZnF_C2H2	461	483	2.24e-3	SMART
ZnF_C2H2	490	512	1.56e-2	SMART
ZnF_C2H2	518	540	1.63e-5	SMART
ZnF_C2H2	546	568	1.95e-3	SMART
ZnF_C2H2	574	596	5.9e-3	SMART
ZnF_C2H2	602	624	2.36e-2	SMART
ZnF_C2H2	630	652	2.24e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000216150
AA Change: H454L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.9597

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (82/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	A	T	2: 91,383,773	L79H	probably damaging	Het
2810474O19Rik	A	G	6: 149,325,438		probably benign	Het
Abca15	A	T	7: 120,365,821	I769F	possibly damaging	Het
Ackr1	A	C	1: 173,332,212	W247G	probably damaging	Het
Adgrl4	G	A	3: 151,492,309	G69S	probably damaging	Het
Agrn	C	T	4: 156,176,429	S710N	probably damaging	Het
Aox3	A	G	1: 58,179,335	M1103V	probably benign	Het
Asb18	G	A	1: 89,968,484	A278V	probably benign	Het
B3gat2	A	G	1: 23,762,864	E77G	probably benign	Het
C87499	T	C	4: 88,629,119	D192G	probably benign	Het
Camta1	T	C	4: 151,148,406		probably null	Het
Cbll1	A	T	12: 31,487,580	I392N	probably damaging	Het
Ccdc113	A	G	8: 95,538,201	D113G	possibly damaging	Het
Cd79a	T	C	7: 24,899,667	F148L	probably benign	Het
Chad	T	A	11: 94,565,173	C26S	probably damaging	Het
Cog4	T	C	8: 110,880,968	F696L	probably damaging	Het
Csf2rb	T	G	15: 78,341,639	S303R	probably damaging	Het
Cubn	C	T	2: 13,360,365	G1621R	probably damaging	Het
Dennd4c	T	A	4: 86,828,942	N1454K	probably benign	Het
Dennd5b	T	C	6: 149,017,106	I853V	probably benign	Het
Dopey1	A	T	9: 86,507,730	D561V	probably benign	Het
Dpysl4	A	G	7: 139,089,540	I45V	probably benign	Het
Ect2l	A	C	10: 18,169,405	S301A	possibly damaging	Het
Elf2	A	G	3: 51,257,614	V323A	probably damaging	Het
Epcam	C	T	17: 87,640,476	R125*	probably null	Het
Ephb4	T	C	5: 137,365,675	V612A	probably damaging	Het
Erich3	C	T	3: 154,763,789	R1293C	unknown	Het
F830045P16Rik	C	A	2: 129,460,447	L408F	probably damaging	Het
Fam198a	G	A	9: 121,964,821	V14I	probably benign	Het
Gm13102	T	C	4: 144,109,217	I485T	probably benign	Het
Gm14548	T	A	7: 3,895,604	I282F	probably damaging	Het
Gm16494	A	T	17: 47,016,874	L28*	probably null	Het
Grin2c	A	G	11: 115,253,870	V610A	probably damaging	Het
Hacd2	T	A	16: 35,102,064	Y208N	probably damaging	Het
Hlf	A	T	11: 90,387,995	F81Y	probably damaging	Het
Igfbp7	G	A	5: 77,351,287	A257V	probably damaging	Het
Il12a	A	T	3: 68,697,902	N167I	probably damaging	Het
Il1r2	G	A	1: 40,123,211	C338Y	probably damaging	Het
Irf2bpl	G	T	12: 86,883,715	H61Q	probably damaging	Het
Kansl1	A	G	11: 104,424,064	F383L	probably benign	Het
Kcnh8	A	G	17: 52,961,843	T863A	probably damaging	Het
Klhl36	C	A	8: 119,869,658	Q33K	probably benign	Het
Lrig2	A	T	3: 104,494,669	Y113*	probably null	Het
Lrrc36	T	A	8: 105,452,035	S287R	possibly damaging	Het
Lrrc6	T	C	15: 66,449,563	E243G	probably benign	Het
Mr1	A	T	1: 155,129,308	Y329N	probably damaging	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Nectin4	G	A	1: 171,383,758		probably null	Het
Nsrp1	A	G	11: 77,049,271		probably null	Het
Olfr1012	A	G	2: 85,753,492	T44A	probably benign	Het
Olfr380	A	T	11: 73,453,546	I222N	possibly damaging	Het
Pcdh8	A	T	14: 79,770,703	I140N	probably damaging	Het
Pdzd8	A	G	19: 59,344,776	V271A	probably damaging	Het
Pex3	T	A	10: 13,527,806	I324L	possibly damaging	Het
Pitpnm1	T	A	19: 4,103,470	F209I	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Pkhd1	T	A	1: 20,200,925	T3135S	probably damaging	Het
Prdm16	T	C	4: 154,328,299	N1082S	probably damaging	Het
Psmd12	A	T	11: 107,479,613	I13F	possibly damaging	Het
Ptgs2	A	T	1: 150,104,507	I399F	probably benign	Het
Rasa3	A	T	8: 13,568,708	S830T	probably benign	Het
Rasgef1c	A	T	11: 49,970,293	R362W	probably damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnf217	C	A	10: 31,517,419	G389W	probably damaging	Het
Sec16b	A	T	1: 157,558,060	D675V	probably damaging	Het
Serpinb12	A	G	1: 106,949,671	Y137C	probably damaging	Het
Slc2a5	T	A	4: 150,143,134	I470N	probably damaging	Het
Slc5a1	T	C	5: 33,133,417	I115T	possibly damaging	Het
Slco1a4	A	T	6: 141,834,687	S126T	possibly damaging	Het
St6galnac2	T	C	11: 116,677,584	D351G	probably damaging	Het
Stat4	G	A	1: 52,082,552	V357M	possibly damaging	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tdrd9	T	A	12: 111,992,548	C139S	probably benign	Het
Tmed9	G	A	13: 55,593,241	R23Q	not run	Het
Tmem150a	A	C	6: 72,359,045	H205P	probably damaging	Het
Tns2	C	A	15: 102,109,728	L350I	probably benign	Het
Tpr	A	G	1: 150,419,895	T964A	probably benign	Het
Traf3ip1	G	T	1: 91,494,757		probably benign	Het
Trem2	G	T	17: 48,346,539		probably benign	Het
Ttc14	G	A	3: 33,809,441	G666D	unknown	Het
Ulk1	T	C	5: 110,809,212	D40G	probably damaging	Het
Vmn1r30	A	G	6: 58,435,412	V145A	probably benign	Het
Vmn1r79	C	T	7: 12,176,835	Q215*	probably null	Het
Wnk2	G	A	13: 49,078,017	T16I	unknown	Het
Yme1l1	T	C	2: 23,187,844		probably null	Het
Zkscan5	A	C	5: 145,220,866	H726P	probably damaging	Het
Zrsr1	A	G	11: 22,973,595	Q123R	possibly damaging	Het

Other mutations in Zbtb16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01977:Zbtb16	APN	9	48657183	missense	probably damaging	1.00
R0324:Zbtb16	UTSW	9	48665275	missense	possibly damaging	0.82
R0364:Zbtb16	UTSW	9	48743576	splice site	probably benign
R1538:Zbtb16	UTSW	9	48832283	missense	probably benign
R1575:Zbtb16	UTSW	9	48832272	missense	probably damaging	0.96
R1937:Zbtb16	UTSW	9	48659778	missense	probably benign
R2656:Zbtb16	UTSW	9	48832688	missense	probably damaging	1.00
R4176:Zbtb16	UTSW	9	48659801	missense	probably damaging	1.00
R4582:Zbtb16	UTSW	9	48832082	missense	probably benign
R4595:Zbtb16	UTSW	9	48832080	missense	possibly damaging	0.79
R6466:Zbtb16	UTSW	9	48665319	missense	possibly damaging	0.95
R6966:Zbtb16	UTSW	9	48657354	missense	probably damaging	1.00
R7596:Zbtb16	UTSW	9	48832404	missense	possibly damaging	0.93
R7904:Zbtb16	UTSW	9	48832972	missense	probably damaging	1.00
R8922:Zbtb16	UTSW	9	48832557	missense	probably benign
Z1176:Zbtb16	UTSW	9	48657288	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTATGTTCCTCTGATGGGCAC -3'
(R):5'- GGAGATTACTCTGAAAGCCTGTAG -3'

Sequencing Primer
(F):5'- GTGAAGACAACTAGACCAGG -3'
(R):5'- CCTGTAGGCGTGTGTGTG -3'

Posted On

2019-11-26