Incidental Mutation 'R7751:Csf2rb'
ID 597264
Institutional Source Beutler Lab
Gene Symbol Csf2rb
Ensembl Gene ENSMUSG00000071713
Gene Name colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131
MMRRC Submission
Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7751 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 78325752-78353847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 78341639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 303 (S303R)
Ref Sequence ENSEMBL: ENSMUSP00000094082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229678] [ENSMUST00000230264] [ENSMUST00000231888]
AlphaFold P26955
Predicted Effect probably damaging
Transcript: ENSMUST00000096355
AA Change: S303R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: S303R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1gh7a1 29 130 6e-58 SMART
FN3 136 224 4.44e0 SMART
Blast:FN3 245 338 3e-24 BLAST
SCOP:d1gh7a3 245 338 2e-45 SMART
FN3 343 426 2.41e0 SMART
transmembrane domain 446 468 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229678
AA Change: S303R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230264
AA Change: S303R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231888
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,383,773 L79H probably damaging Het
2810474O19Rik A G 6: 149,325,438 probably benign Het
Abca15 A T 7: 120,365,821 I769F possibly damaging Het
Ackr1 A C 1: 173,332,212 W247G probably damaging Het
Adgrl4 G A 3: 151,492,309 G69S probably damaging Het
Agrn C T 4: 156,176,429 S710N probably damaging Het
Aox3 A G 1: 58,179,335 M1103V probably benign Het
Asb18 G A 1: 89,968,484 A278V probably benign Het
B3gat2 A G 1: 23,762,864 E77G probably benign Het
C87499 T C 4: 88,629,119 D192G probably benign Het
Camta1 T C 4: 151,148,406 probably null Het
Cbll1 A T 12: 31,487,580 I392N probably damaging Het
Ccdc113 A G 8: 95,538,201 D113G possibly damaging Het
Cd79a T C 7: 24,899,667 F148L probably benign Het
Chad T A 11: 94,565,173 C26S probably damaging Het
Cog4 T C 8: 110,880,968 F696L probably damaging Het
Cubn C T 2: 13,360,365 G1621R probably damaging Het
Dennd4c T A 4: 86,828,942 N1454K probably benign Het
Dennd5b T C 6: 149,017,106 I853V probably benign Het
Dopey1 A T 9: 86,507,730 D561V probably benign Het
Dpysl4 A G 7: 139,089,540 I45V probably benign Het
Ect2l A C 10: 18,169,405 S301A possibly damaging Het
Elf2 A G 3: 51,257,614 V323A probably damaging Het
Epcam C T 17: 87,640,476 R125* probably null Het
Ephb4 T C 5: 137,365,675 V612A probably damaging Het
Erich3 C T 3: 154,763,789 R1293C unknown Het
F830045P16Rik C A 2: 129,460,447 L408F probably damaging Het
Fam198a G A 9: 121,964,821 V14I probably benign Het
Gm13102 T C 4: 144,109,217 I485T probably benign Het
Gm14548 T A 7: 3,895,604 I282F probably damaging Het
Gm16494 A T 17: 47,016,874 L28* probably null Het
Grin2c A G 11: 115,253,870 V610A probably damaging Het
Hacd2 T A 16: 35,102,064 Y208N probably damaging Het
Hlf A T 11: 90,387,995 F81Y probably damaging Het
Igfbp7 G A 5: 77,351,287 A257V probably damaging Het
Il12a A T 3: 68,697,902 N167I probably damaging Het
Il1r2 G A 1: 40,123,211 C338Y probably damaging Het
Irf2bpl G T 12: 86,883,715 H61Q probably damaging Het
Kansl1 A G 11: 104,424,064 F383L probably benign Het
Kcnh8 A G 17: 52,961,843 T863A probably damaging Het
Klhl36 C A 8: 119,869,658 Q33K probably benign Het
Lrig2 A T 3: 104,494,669 Y113* probably null Het
Lrrc36 T A 8: 105,452,035 S287R possibly damaging Het
Lrrc6 T C 15: 66,449,563 E243G probably benign Het
Mr1 A T 1: 155,129,308 Y329N probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nectin4 G A 1: 171,383,758 probably null Het
Nsrp1 A G 11: 77,049,271 probably null Het
Olfr1012 A G 2: 85,753,492 T44A probably benign Het
Olfr380 A T 11: 73,453,546 I222N possibly damaging Het
Pcdh8 A T 14: 79,770,703 I140N probably damaging Het
Pdzd8 A G 19: 59,344,776 V271A probably damaging Het
Pex3 T A 10: 13,527,806 I324L possibly damaging Het
Pitpnm1 T A 19: 4,103,470 F209I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1 T A 1: 20,200,925 T3135S probably damaging Het
Prdm16 T C 4: 154,328,299 N1082S probably damaging Het
Psmd12 A T 11: 107,479,613 I13F possibly damaging Het
Ptgs2 A T 1: 150,104,507 I399F probably benign Het
Rasa3 A T 8: 13,568,708 S830T probably benign Het
Rasgef1c A T 11: 49,970,293 R362W probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf217 C A 10: 31,517,419 G389W probably damaging Het
Sec16b A T 1: 157,558,060 D675V probably damaging Het
Serpinb12 A G 1: 106,949,671 Y137C probably damaging Het
Slc2a5 T A 4: 150,143,134 I470N probably damaging Het
Slc5a1 T C 5: 33,133,417 I115T possibly damaging Het
Slco1a4 A T 6: 141,834,687 S126T possibly damaging Het
St6galnac2 T C 11: 116,677,584 D351G probably damaging Het
Stat4 G A 1: 52,082,552 V357M possibly damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tdrd9 T A 12: 111,992,548 C139S probably benign Het
Tmed9 G A 13: 55,593,241 R23Q not run Het
Tmem150a A C 6: 72,359,045 H205P probably damaging Het
Tns2 C A 15: 102,109,728 L350I probably benign Het
Tpr A G 1: 150,419,895 T964A probably benign Het
Traf3ip1 G T 1: 91,494,757 probably benign Het
Trem2 G T 17: 48,346,539 probably benign Het
Ttc14 G A 3: 33,809,441 G666D unknown Het
Ulk1 T C 5: 110,809,212 D40G probably damaging Het
Vmn1r30 A G 6: 58,435,412 V145A probably benign Het
Vmn1r79 C T 7: 12,176,835 Q215* probably null Het
Wnk2 G A 13: 49,078,017 T16I unknown Het
Yme1l1 T C 2: 23,187,844 probably null Het
Zbtb16 T A 9: 48,743,469 H454L probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zrsr1 A G 11: 22,973,595 Q123R possibly damaging Het
Other mutations in Csf2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Csf2rb APN 15 78348514 nonsense probably null
IGL00979:Csf2rb APN 15 78348104 missense probably damaging 1.00
IGL01613:Csf2rb APN 15 78335302 intron probably benign
IGL01724:Csf2rb APN 15 78336414 missense probably damaging 1.00
IGL01942:Csf2rb APN 15 78340492 missense probably benign
IGL02479:Csf2rb APN 15 78341724 nonsense probably null
3-1:Csf2rb UTSW 15 78344603 missense probably damaging 1.00
IGL02802:Csf2rb UTSW 15 78338903 missense probably benign 0.00
R0133:Csf2rb UTSW 15 78339004 unclassified probably benign
R0179:Csf2rb UTSW 15 78336372 missense possibly damaging 0.52
R0487:Csf2rb UTSW 15 78348331 missense probably benign 0.00
R1544:Csf2rb UTSW 15 78340755 missense probably benign 0.02
R1619:Csf2rb UTSW 15 78335211 missense probably damaging 0.99
R1690:Csf2rb UTSW 15 78348644 missense probably benign 0.11
R1831:Csf2rb UTSW 15 78348253 missense probably benign 0.03
R3970:Csf2rb UTSW 15 78341467 missense probably benign
R4922:Csf2rb UTSW 15 78346467 missense probably benign 0.02
R5151:Csf2rb UTSW 15 78340581 missense probably damaging 1.00
R5202:Csf2rb UTSW 15 78349057 missense possibly damaging 0.51
R5398:Csf2rb UTSW 15 78348620 missense probably benign
R5496:Csf2rb UTSW 15 78340561 missense probably damaging 1.00
R5786:Csf2rb UTSW 15 78348955 missense probably damaging 1.00
R6166:Csf2rb UTSW 15 78344566 missense probably damaging 1.00
R6347:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6350:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6899:Csf2rb UTSW 15 78340702 missense probably benign 0.01
R6984:Csf2rb UTSW 15 78345519 missense probably damaging 1.00
R7484:Csf2rb UTSW 15 78338899 missense possibly damaging 0.53
R7671:Csf2rb UTSW 15 78338930 missense probably damaging 1.00
R7781:Csf2rb UTSW 15 78344571 missense probably benign 0.00
R7861:Csf2rb UTSW 15 78349157 missense probably damaging 1.00
R8135:Csf2rb UTSW 15 78348119 missense possibly damaging 0.95
R8154:Csf2rb UTSW 15 78340442 critical splice acceptor site probably null
R8299:Csf2rb UTSW 15 78346469 missense possibly damaging 0.88
R8315:Csf2rb UTSW 15 78347381 missense possibly damaging 0.83
R8926:Csf2rb UTSW 15 78340549 missense probably benign
R8948:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R8950:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R9265:Csf2rb UTSW 15 78348546 missense probably benign 0.08
X0024:Csf2rb UTSW 15 78336360 missense probably damaging 1.00
X0028:Csf2rb UTSW 15 78349002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACGACTGGCTCTGTTTC -3'
(R):5'- ATTTATTGGCATAACTCAATGGACCCC -3'

Sequencing Primer
(F):5'- TATCGCCCCAGCCCTGTAG -3'
(R):5'- TCAATGGACCCCTATAGTACTGGG -3'
Posted On 2019-11-26