Incidental Mutation 'R7751:Pdzd8'
ID 597272
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene Name PDZ domain containing 8
Synonyms Pdzk8, A630041P07Rik
MMRRC Submission 045807-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7751 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 59285610-59334212 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59333208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 271 (V271A)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099274]
AlphaFold B9EJ80
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: V271A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: V271A

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,965,044 (GRCm39) I769F possibly damaging Het
Ackr1 A C 1: 173,159,779 (GRCm39) W247G probably damaging Het
Adgrl4 G A 3: 151,197,946 (GRCm39) G69S probably damaging Het
Agrn C T 4: 156,260,886 (GRCm39) S710N probably damaging Het
Aox3 A G 1: 58,218,494 (GRCm39) M1103V probably benign Het
Asb18 G A 1: 89,896,206 (GRCm39) A278V probably benign Het
B3gat2 A G 1: 23,801,945 (GRCm39) E77G probably benign Het
Camta1 T C 4: 151,232,863 (GRCm39) probably null Het
Cbll1 A T 12: 31,537,579 (GRCm39) I392N probably damaging Het
Ccdc113 A G 8: 96,264,829 (GRCm39) D113G possibly damaging Het
Cd79a T C 7: 24,599,092 (GRCm39) F148L probably benign Het
Chad T A 11: 94,455,999 (GRCm39) C26S probably damaging Het
Cog4 T C 8: 111,607,600 (GRCm39) F696L probably damaging Het
Csf2rb T G 15: 78,225,839 (GRCm39) S303R probably damaging Het
Cstpp1 A T 2: 91,214,118 (GRCm39) L79H probably damaging Het
Cubn C T 2: 13,365,176 (GRCm39) G1621R probably damaging Het
Dennd4c T A 4: 86,747,179 (GRCm39) N1454K probably benign Het
Dennd5b T C 6: 148,918,604 (GRCm39) I853V probably benign Het
Dnaaf11 T C 15: 66,321,412 (GRCm39) E243G probably benign Het
Dop1a A T 9: 86,389,783 (GRCm39) D561V probably benign Het
Dpysl4 A G 7: 138,669,456 (GRCm39) I45V probably benign Het
Ect2l A C 10: 18,045,153 (GRCm39) S301A possibly damaging Het
Elf2 A G 3: 51,165,035 (GRCm39) V323A probably damaging Het
Epcam C T 17: 87,947,904 (GRCm39) R125* probably null Het
Ephb4 T C 5: 137,363,937 (GRCm39) V612A probably damaging Het
Erich3 C T 3: 154,469,426 (GRCm39) R1293C unknown Het
F830045P16Rik C A 2: 129,302,367 (GRCm39) L408F probably damaging Het
Gask1a G A 9: 121,793,887 (GRCm39) V14I probably benign Het
Gm13102 T C 4: 143,835,787 (GRCm39) I485T probably benign Het
Gm16494 A T 17: 47,327,800 (GRCm39) L28* probably null Het
Grin2c A G 11: 115,144,696 (GRCm39) V610A probably damaging Het
Hacd2 T A 16: 34,922,434 (GRCm39) Y208N probably damaging Het
Hlf A T 11: 90,278,821 (GRCm39) F81Y probably damaging Het
Igfbp7 G A 5: 77,499,134 (GRCm39) A257V probably damaging Het
Il12a A T 3: 68,605,235 (GRCm39) N167I probably damaging Het
Il1r2 G A 1: 40,162,371 (GRCm39) C338Y probably damaging Het
Irf2bpl G T 12: 86,930,489 (GRCm39) H61Q probably damaging Het
Kansl1 A G 11: 104,314,890 (GRCm39) F383L probably benign Het
Kcnh8 A G 17: 53,268,871 (GRCm39) T863A probably damaging Het
Klhl36 C A 8: 120,596,397 (GRCm39) Q33K probably benign Het
Lrig2 A T 3: 104,401,985 (GRCm39) Y113* probably null Het
Lrrc36 T A 8: 106,178,667 (GRCm39) S287R possibly damaging Het
Mr1 A T 1: 155,005,054 (GRCm39) Y329N probably damaging Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nectin4 G A 1: 171,211,326 (GRCm39) probably null Het
Nsrp1 A G 11: 76,940,097 (GRCm39) probably null Het
Or1e21 A T 11: 73,344,372 (GRCm39) I222N possibly damaging Het
Or9g3 A G 2: 85,583,836 (GRCm39) T44A probably benign Het
Pcdh8 A T 14: 80,008,143 (GRCm39) I140N probably damaging Het
Pex3 T A 10: 13,403,550 (GRCm39) I324L possibly damaging Het
Pira12 T A 7: 3,898,603 (GRCm39) I282F probably damaging Het
Pitpnm1 T A 19: 4,153,470 (GRCm39) F209I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pkhd1 T A 1: 20,271,149 (GRCm39) T3135S probably damaging Het
Pramel32 T C 4: 88,547,356 (GRCm39) D192G probably benign Het
Prdm16 T C 4: 154,412,756 (GRCm39) N1082S probably damaging Het
Psmd12 A T 11: 107,370,439 (GRCm39) I13F possibly damaging Het
Ptgs2 A T 1: 149,980,258 (GRCm39) I399F probably benign Het
Rasa3 A T 8: 13,618,708 (GRCm39) S830T probably benign Het
Rasgef1c A T 11: 49,861,120 (GRCm39) R362W probably damaging Het
Resf1 A G 6: 149,226,936 (GRCm39) probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rnf217 C A 10: 31,393,415 (GRCm39) G389W probably damaging Het
Sec16b A T 1: 157,385,630 (GRCm39) D675V probably damaging Het
Serpinb12 A G 1: 106,877,401 (GRCm39) Y137C probably damaging Het
Slc2a5 T A 4: 150,227,591 (GRCm39) I470N probably damaging Het
Slc5a1 T C 5: 33,290,761 (GRCm39) I115T possibly damaging Het
Slco1a4 A T 6: 141,780,413 (GRCm39) S126T possibly damaging Het
St6galnac2 T C 11: 116,568,410 (GRCm39) D351G probably damaging Het
Stat4 G A 1: 52,121,711 (GRCm39) V357M possibly damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tdrd9 T A 12: 111,958,982 (GRCm39) C139S probably benign Het
Tmed9 G A 13: 55,741,054 (GRCm39) R23Q not run Het
Tmem150a A C 6: 72,336,028 (GRCm39) H205P probably damaging Het
Tns2 C A 15: 102,018,163 (GRCm39) L350I probably benign Het
Tpr A G 1: 150,295,646 (GRCm39) T964A probably benign Het
Traf3ip1 G T 1: 91,422,479 (GRCm39) probably benign Het
Trem2 G T 17: 48,653,567 (GRCm39) probably benign Het
Ttc14 G A 3: 33,863,590 (GRCm39) G666D unknown Het
Ulk1 T C 5: 110,957,078 (GRCm39) D40G probably damaging Het
Vmn1r30 A G 6: 58,412,397 (GRCm39) V145A probably benign Het
Vmn1r79 C T 7: 11,910,762 (GRCm39) Q215* probably null Het
Wnk2 G A 13: 49,231,493 (GRCm39) T16I unknown Het
Yme1l1 T C 2: 23,077,856 (GRCm39) probably null Het
Zbtb16 T A 9: 48,654,769 (GRCm39) H454L probably damaging Het
Zkscan5 A C 5: 145,157,676 (GRCm39) H726P probably damaging Het
Zrsr2-ps1 A G 11: 22,923,595 (GRCm39) Q123R possibly damaging Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59,288,218 (GRCm39) missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59,289,961 (GRCm39) missense probably benign
IGL01865:Pdzd8 APN 19 59,288,077 (GRCm39) missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59,303,724 (GRCm39) missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59,288,922 (GRCm39) missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59,289,060 (GRCm39) missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59,289,825 (GRCm39) missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59,288,215 (GRCm39) nonsense probably null
IGL02713:Pdzd8 APN 19 59,333,890 (GRCm39) missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59,288,804 (GRCm39) nonsense probably null
IGL02966:Pdzd8 APN 19 59,289,291 (GRCm39) missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59,288,940 (GRCm39) missense probably damaging 1.00
citadel UTSW 19 59,287,957 (GRCm39) makesense probably null
Eleventh_hour UTSW 19 59,293,662 (GRCm39) missense probably damaging 1.00
keep UTSW 19 59,289,783 (GRCm39) nonsense probably null
Stronghold UTSW 19 59,333,784 (GRCm39) nonsense probably null
R0018:Pdzd8 UTSW 19 59,289,105 (GRCm39) missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59,288,028 (GRCm39) missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59,289,563 (GRCm39) missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59,288,811 (GRCm39) missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59,288,811 (GRCm39) missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59,289,361 (GRCm39) missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59,333,365 (GRCm39) missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59,288,904 (GRCm39) missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59,289,771 (GRCm39) missense probably benign
R1965:Pdzd8 UTSW 19 59,288,554 (GRCm39) missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59,288,853 (GRCm39) missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59,293,588 (GRCm39) critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59,333,845 (GRCm39) missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59,288,560 (GRCm39) missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59,333,913 (GRCm39) missense probably benign
R4504:Pdzd8 UTSW 19 59,333,880 (GRCm39) missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59,293,662 (GRCm39) missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59,333,743 (GRCm39) missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59,289,292 (GRCm39) missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59,289,236 (GRCm39) nonsense probably null
R5176:Pdzd8 UTSW 19 59,333,389 (GRCm39) missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59,289,458 (GRCm39) missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59,288,057 (GRCm39) missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59,288,972 (GRCm39) missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59,333,718 (GRCm39) missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59,293,641 (GRCm39) missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59,293,641 (GRCm39) missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59,288,994 (GRCm39) missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59,289,415 (GRCm39) missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59,333,298 (GRCm39) missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59,289,801 (GRCm39) missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59,287,957 (GRCm39) makesense probably null
R6902:Pdzd8 UTSW 19 59,289,829 (GRCm39) missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59,333,784 (GRCm39) nonsense probably null
R7088:Pdzd8 UTSW 19 59,333,389 (GRCm39) missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59,288,125 (GRCm39) missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59,288,589 (GRCm39) missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59,333,571 (GRCm39) missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59,289,077 (GRCm39) missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59,289,783 (GRCm39) nonsense probably null
R7699:Pdzd8 UTSW 19 59,333,373 (GRCm39) missense probably damaging 1.00
R7759:Pdzd8 UTSW 19 59,288,358 (GRCm39) missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59,316,295 (GRCm39) missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59,333,518 (GRCm39) missense probably damaging 0.96
R9364:Pdzd8 UTSW 19 59,333,574 (GRCm39) missense probably damaging 1.00
R9368:Pdzd8 UTSW 19 59,289,219 (GRCm39) nonsense probably null
R9406:Pdzd8 UTSW 19 59,333,245 (GRCm39) missense
R9548:Pdzd8 UTSW 19 59,289,826 (GRCm39) missense probably benign 0.13
R9554:Pdzd8 UTSW 19 59,333,574 (GRCm39) missense probably damaging 1.00
R9688:Pdzd8 UTSW 19 59,333,683 (GRCm39) missense probably benign 0.05
R9750:Pdzd8 UTSW 19 59,289,684 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACTTTTCCACGTGGTGCAG -3'
(R):5'- ACCTGTTCGTGAAGCTGTC -3'

Sequencing Primer
(F):5'- GCCTTCCGGTTGCAACAAC -3'
(R):5'- TCGTGAAGCTGTCTCGCG -3'
Posted On 2019-11-26