Incidental Mutation 'R7752:Il1f8'
ID597276
Institutional Source Beutler Lab
Gene Symbol Il1f8
Ensembl Gene ENSMUSG00000026985
Gene Nameinterleukin 1 family, member 8
Synonyms2310043N20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location24153161-24160519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24158814 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 77 (T77M)
Ref Sequence ENSEMBL: ENSMUSP00000028363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028363
AA Change: T77M

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028363
Gene: ENSMUSG00000026985
AA Change: T77M

DomainStartEndE-ValueType
IL1 33 180 3.19e-22 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Il1f8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Il1f8 APN 2 24159913 missense probably benign 0.00
IGL01944:Il1f8 APN 2 24155279 missense probably damaging 1.00
IGL02379:Il1f8 APN 2 24154638 missense probably benign 0.01
R0035:Il1f8 UTSW 2 24159878 missense probably benign 0.19
R0035:Il1f8 UTSW 2 24159878 missense probably benign 0.19
R2137:Il1f8 UTSW 2 24154660 missense probably benign 0.00
R2139:Il1f8 UTSW 2 24154660 missense probably benign 0.00
R4052:Il1f8 UTSW 2 24159832 missense probably damaging 1.00
R4096:Il1f8 UTSW 2 24158814 missense possibly damaging 0.66
R4705:Il1f8 UTSW 2 24154618 missense probably benign 0.00
R5785:Il1f8 UTSW 2 24154649 missense probably benign 0.00
R6541:Il1f8 UTSW 2 24159815 missense probably damaging 1.00
R7517:Il1f8 UTSW 2 24159878 missense probably benign 0.02
R7858:Il1f8 UTSW 2 24154614 missense probably benign 0.00
R8252:Il1f8 UTSW 2 24158813 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TACATGGCTAACGTGGGAAAC -3'
(R):5'- TGTGAGTGATACAAGCTTTCATGG -3'

Sequencing Primer
(F):5'- CTAACGTGGGAAACTGGGATG -3'
(R):5'- ACAAGCTTTCATGGCTACACTG -3'
Posted On2019-11-26