Incidental Mutation 'R7752:Thbd'
ID597280
Institutional Source Beutler Lab
Gene Symbol Thbd
Ensembl Gene ENSMUSG00000074743
Gene Namethrombomodulin
SynonymsCD141, TM
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location148404466-148408188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 148406974 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 325 (V325L)
Ref Sequence ENSEMBL: ENSMUSP00000096877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099270]
Predicted Effect probably damaging
Transcript: ENSMUST00000099270
AA Change: V325L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096877
Gene: ENSMUSG00000074743
AA Change: V325L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
CLECT 24 166 2.78e-18 SMART
EGF 243 280 2.2e1 SMART
EGF 286 323 1.47e-3 SMART
EGF_CA 324 362 7.81e-8 SMART
EGF 367 404 3.57e-2 SMART
EGF 406 439 2.53e1 SMART
EGF 443 480 2.39e1 SMART
low complexity region 490 511 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is an endothelial-specific type I membrane receptor that binds thrombin. This binding results in the activation of protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated. Mutations in this gene are a cause of thromboembolic disease, also known as inherited thrombophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants are growth retarded and die by embryonic day 9.5. Embryos develop further in vitro than in vivo suggesting maternal-fetal incompatibility. Endothelial cell-specific, conditional knockouts suffer fatal juvenile thromboses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Thbd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Thbd APN 2 148407682 nonsense probably null
IGL01510:Thbd APN 2 148406974 missense probably damaging 1.00
IGL01845:Thbd APN 2 148407096 missense probably benign
IGL01892:Thbd APN 2 148407068 missense possibly damaging 0.68
IGL02039:Thbd APN 2 148406542 missense probably benign 0.05
IGL02261:Thbd APN 2 148406481 missense probably benign
IGL02941:Thbd APN 2 148407034 missense probably damaging 1.00
IGL03110:Thbd APN 2 148406796 missense probably benign
IGL03111:Thbd APN 2 148406472 missense probably benign 0.00
F5770:Thbd UTSW 2 148407190 missense probably benign 0.05
PIT4283001:Thbd UTSW 2 148407083 missense probably benign 0.19
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R1847:Thbd UTSW 2 148407684 nonsense probably null
R1957:Thbd UTSW 2 148406979 missense probably damaging 0.97
R2320:Thbd UTSW 2 148406646 missense probably damaging 1.00
R2362:Thbd UTSW 2 148406364 missense probably damaging 1.00
R2900:Thbd UTSW 2 148406214 makesense probably null
R3623:Thbd UTSW 2 148406973 missense probably damaging 1.00
R4839:Thbd UTSW 2 148406671 missense probably damaging 1.00
R4936:Thbd UTSW 2 148407735 missense probably damaging 1.00
R5296:Thbd UTSW 2 148406983 missense probably damaging 1.00
R5521:Thbd UTSW 2 148407735 missense probably damaging 1.00
R5677:Thbd UTSW 2 148407366 missense probably damaging 1.00
R6581:Thbd UTSW 2 148406272 missense probably benign
R7139:Thbd UTSW 2 148406541 missense probably benign 0.37
R7246:Thbd UTSW 2 148406485 missense probably benign
R7655:Thbd UTSW 2 148407420 missense probably damaging 1.00
R7656:Thbd UTSW 2 148407420 missense probably damaging 1.00
R7867:Thbd UTSW 2 148407744 missense probably damaging 1.00
V7582:Thbd UTSW 2 148407190 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGCAGAACATTTCGCACTTGTG -3'
(R):5'- ATGAACCCAGATGCCTCTGC -3'

Sequencing Primer
(F):5'- AGCGCAGATGCATCGGTAGTC -3'
(R):5'- TCTGCCCCAGAGACATGGAC -3'
Posted On2019-11-26