Incidental Mutation 'R0632:Ccdc88a'
ID 59729
Institutional Source Beutler Lab
Gene Symbol Ccdc88a
Ensembl Gene ENSMUSG00000032740
Gene Name coiled coil domain containing 88A
Synonyms GIV, Girdin, D130005J21Rik, HkRP1, C330012F17Rik, C130096N06Rik, A430106J12Rik
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0632 (G1)
Quality Score 195
Status Validated
Chromosome 11
Chromosomal Location 29323658-29460808 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 29432749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040182] [ENSMUST00000140194] [ENSMUST00000155854]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040182
SMART Domains Protein: ENSMUSP00000048978
Gene: ENSMUSG00000032740

DomainStartEndE-ValueType
Pfam:HOOK 14 590 8.1e-36 PFAM
low complexity region 614 625 N/A INTRINSIC
Blast:BRLZ 665 719 6e-22 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
low complexity region 955 985 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1268 1385 N/A INTRINSIC
low complexity region 1437 1444 N/A INTRINSIC
low complexity region 1566 1576 N/A INTRINSIC
internal_repeat_1 1609 1702 2.38e-6 PROSPERO
internal_repeat_1 1708 1808 2.38e-6 PROSPERO
low complexity region 1811 1824 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123561
SMART Domains Protein: ENSMUSP00000119173
Gene: ENSMUSG00000032740

DomainStartEndE-ValueType
coiled coil region 1 212 N/A INTRINSIC
coiled coil region 248 365 N/A INTRINSIC
low complexity region 418 425 N/A INTRINSIC
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140194
SMART Domains Protein: ENSMUSP00000114942
Gene: ENSMUSG00000032740

DomainStartEndE-ValueType
coiled coil region 3 85 N/A INTRINSIC
low complexity region 137 144 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155854
SMART Domains Protein: ENSMUSP00000115117
Gene: ENSMUSG00000032740

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 146 176 N/A INTRINSIC
Blast:BRLZ 228 283 7e-6 BLAST
low complexity region 284 295 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Girdin family of coiled-coil domain containing proteins. The encoded protein is an actin-binding protein that is activated by the serine/threonine kinase Akt and plays a role in cytoskeleton remodeling and cell migration. The encoded protein also enhances Akt signaling by mediating phosphoinositide 3-kinase (PI3K)-dependent activation of Akt by growth factor receptor tyrosine kinases and G protein-coupled receptors. Increased expression of this gene and phosphorylation of the encoded protein may play a role in cancer metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal weight loss, reduced angiogenesis, and premature death by P25. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Ccdc88a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Ccdc88a APN 11 29,449,341 (GRCm39) missense probably benign 0.24
IGL00577:Ccdc88a APN 11 29,374,772 (GRCm39) missense probably damaging 1.00
IGL00766:Ccdc88a APN 11 29,451,046 (GRCm39) missense probably damaging 0.99
IGL01384:Ccdc88a APN 11 29,453,915 (GRCm39) missense probably damaging 0.99
IGL01541:Ccdc88a APN 11 29,350,283 (GRCm39) missense probably benign
IGL01647:Ccdc88a APN 11 29,454,321 (GRCm39) unclassified probably benign
IGL02648:Ccdc88a APN 11 29,451,051 (GRCm39) missense probably benign 0.28
IGL02885:Ccdc88a APN 11 29,398,050 (GRCm39) missense probably damaging 1.00
IGL03117:Ccdc88a APN 11 29,324,559 (GRCm39) missense probably damaging 1.00
IGL03196:Ccdc88a APN 11 29,432,340 (GRCm39) missense possibly damaging 0.56
trailor UTSW 11 29,444,099 (GRCm39) splice site probably null
R0011:Ccdc88a UTSW 11 29,324,364 (GRCm39) missense probably damaging 1.00
R0011:Ccdc88a UTSW 11 29,324,364 (GRCm39) missense probably damaging 1.00
R0083:Ccdc88a UTSW 11 29,453,463 (GRCm39) missense probably damaging 0.99
R0108:Ccdc88a UTSW 11 29,453,463 (GRCm39) missense probably damaging 0.99
R0326:Ccdc88a UTSW 11 29,411,021 (GRCm39) missense probably benign 0.01
R0565:Ccdc88a UTSW 11 29,411,042 (GRCm39) unclassified probably benign
R0631:Ccdc88a UTSW 11 29,443,752 (GRCm39) missense probably damaging 0.98
R0762:Ccdc88a UTSW 11 29,413,112 (GRCm39) unclassified probably benign
R0838:Ccdc88a UTSW 11 29,350,285 (GRCm39) missense probably damaging 1.00
R0946:Ccdc88a UTSW 11 29,406,509 (GRCm39) missense probably benign
R1192:Ccdc88a UTSW 11 29,454,049 (GRCm39) missense possibly damaging 0.45
R1500:Ccdc88a UTSW 11 29,432,713 (GRCm39) missense probably benign 0.00
R1701:Ccdc88a UTSW 11 29,427,427 (GRCm39) missense possibly damaging 0.59
R1826:Ccdc88a UTSW 11 29,439,637 (GRCm39) missense possibly damaging 0.58
R1902:Ccdc88a UTSW 11 29,411,788 (GRCm39) missense probably benign 0.07
R1903:Ccdc88a UTSW 11 29,411,788 (GRCm39) missense probably benign 0.07
R2021:Ccdc88a UTSW 11 29,453,480 (GRCm39) missense probably damaging 1.00
R2023:Ccdc88a UTSW 11 29,413,546 (GRCm39) nonsense probably null
R2284:Ccdc88a UTSW 11 29,444,099 (GRCm39) splice site probably null
R3236:Ccdc88a UTSW 11 29,397,995 (GRCm39) missense possibly damaging 0.51
R3409:Ccdc88a UTSW 11 29,436,006 (GRCm39) missense probably damaging 1.00
R3410:Ccdc88a UTSW 11 29,436,006 (GRCm39) missense probably damaging 1.00
R3411:Ccdc88a UTSW 11 29,436,006 (GRCm39) missense probably damaging 1.00
R3430:Ccdc88a UTSW 11 29,398,033 (GRCm39) missense probably damaging 0.98
R3620:Ccdc88a UTSW 11 29,380,227 (GRCm39) missense probably benign 0.16
R4204:Ccdc88a UTSW 11 29,413,399 (GRCm39) missense probably damaging 1.00
R4515:Ccdc88a UTSW 11 29,432,651 (GRCm39) missense probably benign 0.01
R4518:Ccdc88a UTSW 11 29,432,651 (GRCm39) missense probably benign 0.01
R4519:Ccdc88a UTSW 11 29,432,651 (GRCm39) missense probably benign 0.01
R4693:Ccdc88a UTSW 11 29,432,241 (GRCm39) missense probably damaging 1.00
R4705:Ccdc88a UTSW 11 29,372,586 (GRCm39) missense probably benign
R4707:Ccdc88a UTSW 11 29,397,956 (GRCm39) missense probably benign
R4732:Ccdc88a UTSW 11 29,435,906 (GRCm39) missense probably benign 0.02
R4733:Ccdc88a UTSW 11 29,435,906 (GRCm39) missense probably benign 0.02
R4734:Ccdc88a UTSW 11 29,432,720 (GRCm39) missense probably benign
R4749:Ccdc88a UTSW 11 29,432,720 (GRCm39) missense probably benign
R4817:Ccdc88a UTSW 11 29,410,907 (GRCm39) missense probably benign 0.15
R4828:Ccdc88a UTSW 11 29,413,210 (GRCm39) missense probably damaging 1.00
R4979:Ccdc88a UTSW 11 29,432,133 (GRCm39) nonsense probably null
R5288:Ccdc88a UTSW 11 29,448,416 (GRCm39) missense possibly damaging 0.77
R5373:Ccdc88a UTSW 11 29,413,409 (GRCm39) missense possibly damaging 0.92
R5374:Ccdc88a UTSW 11 29,413,409 (GRCm39) missense possibly damaging 0.92
R5401:Ccdc88a UTSW 11 29,413,279 (GRCm39) missense probably benign 0.00
R5586:Ccdc88a UTSW 11 29,453,484 (GRCm39) missense probably benign 0.00
R6660:Ccdc88a UTSW 11 29,432,663 (GRCm39) missense probably benign 0.01
R7116:Ccdc88a UTSW 11 29,454,051 (GRCm39) missense probably benign 0.01
R7353:Ccdc88a UTSW 11 29,413,368 (GRCm39) missense probably benign 0.00
R7538:Ccdc88a UTSW 11 29,413,370 (GRCm39) missense probably benign 0.00
R7663:Ccdc88a UTSW 11 29,448,614 (GRCm39) critical splice donor site probably null
R7769:Ccdc88a UTSW 11 29,432,381 (GRCm39) missense probably damaging 1.00
R7798:Ccdc88a UTSW 11 29,427,348 (GRCm39) missense probably benign 0.15
R7810:Ccdc88a UTSW 11 29,435,964 (GRCm39) missense probably damaging 1.00
R7826:Ccdc88a UTSW 11 29,453,563 (GRCm39) missense probably benign 0.02
R7956:Ccdc88a UTSW 11 29,413,892 (GRCm39) missense probably damaging 1.00
R8260:Ccdc88a UTSW 11 29,443,934 (GRCm39) missense probably benign 0.01
R8402:Ccdc88a UTSW 11 29,413,879 (GRCm39) missense probably damaging 1.00
R8409:Ccdc88a UTSW 11 29,453,544 (GRCm39) missense probably benign
R8555:Ccdc88a UTSW 11 29,380,169 (GRCm39) missense probably benign
R8676:Ccdc88a UTSW 11 29,410,860 (GRCm39) missense probably benign 0.05
R8846:Ccdc88a UTSW 11 29,414,185 (GRCm39) missense probably damaging 1.00
R8963:Ccdc88a UTSW 11 29,448,416 (GRCm39) missense possibly damaging 0.77
R8972:Ccdc88a UTSW 11 29,435,888 (GRCm39) missense probably benign 0.07
R9353:Ccdc88a UTSW 11 29,427,433 (GRCm39) missense probably damaging 1.00
R9362:Ccdc88a UTSW 11 29,453,922 (GRCm39) missense probably null 0.55
R9385:Ccdc88a UTSW 11 29,405,422 (GRCm39) missense probably benign 0.24
R9509:Ccdc88a UTSW 11 29,414,143 (GRCm39) missense probably benign 0.27
R9610:Ccdc88a UTSW 11 29,427,316 (GRCm39) missense possibly damaging 0.76
R9611:Ccdc88a UTSW 11 29,427,316 (GRCm39) missense possibly damaging 0.76
R9664:Ccdc88a UTSW 11 29,405,484 (GRCm39) missense probably benign 0.08
R9720:Ccdc88a UTSW 11 29,413,813 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCACCCTGAAGTCTGCTCAC -3'
(R):5'- CGTATACTGGGCTGGGAAGATGGC -3'

Sequencing Primer
(F):5'- CTTGAAGTGGAACATAAAGACCTTG -3'
(R):5'- Aacacacacacacacacacac -3'
Posted On 2013-07-11