Incidental Mutation 'R7752:Pex5'
ID597294
Institutional Source Beutler Lab
Gene Symbol Pex5
Ensembl Gene ENSMUSG00000005069
Gene Nameperoxisomal biogenesis factor 5
SynonymsESTM1, peroxisome biogenesis factor 5, PTS1R, Pxr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124396816-124415067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124414018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 58 (T58A)
Ref Sequence ENSEMBL: ENSMUSP00000049132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035861] [ENSMUST00000080557] [ENSMUST00000112530] [ENSMUST00000112531] [ENSMUST00000112532]
Predicted Effect probably benign
Transcript: ENSMUST00000035861
AA Change: T58A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000049132
Gene: ENSMUSG00000005069
AA Change: T58A

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080557
AA Change: T58A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000079398
Gene: ENSMUSG00000005069
AA Change: T58A

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112530
AA Change: T58A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108149
Gene: ENSMUSG00000005069
AA Change: T58A

DomainStartEndE-ValueType
low complexity region 224 240 N/A INTRINSIC
TPR 364 397 2.66e0 SMART
low complexity region 436 447 N/A INTRINSIC
TPR 481 514 1.76e-5 SMART
TPR 515 548 1.49e-3 SMART
TPR 549 582 3.87e-2 SMART
low complexity region 615 626 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112531
AA Change: T58A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108150
Gene: ENSMUSG00000005069
AA Change: T58A

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112532
AA Change: T58A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108151
Gene: ENSMUSG00000005069
AA Change: T58A

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal (SKL-type) and plays an essential role in peroxisomal protein import. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of neonatal adrenoleukodystrophy (NALD), a cause of Zellweger syndrome (ZWS) as well as may be a cause of infantile Refsum disease (IRD). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced size, muscle weakness, respiratory distress, and retarded development and defects of the kidney, liver, brain, and intestine associated with lack of peroxisomes, and die within 3-4 days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Pex5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Pex5 APN 6 124398380 missense probably damaging 1.00
IGL02027:Pex5 APN 6 124398888 missense probably benign 0.20
IGL02041:Pex5 APN 6 124405281 splice site probably benign
IGL02128:Pex5 APN 6 124398460 missense probably damaging 1.00
IGL02507:Pex5 APN 6 124413305 missense probably benign
IGL02539:Pex5 APN 6 124403224 missense probably benign 0.02
IGL03180:Pex5 APN 6 124413563 splice site probably benign
R0143:Pex5 UTSW 6 124398489 missense probably damaging 1.00
R0600:Pex5 UTSW 6 124404637 missense probably benign 0.10
R0904:Pex5 UTSW 6 124399937 splice site probably benign
R1970:Pex5 UTSW 6 124414405 missense probably damaging 1.00
R4628:Pex5 UTSW 6 124403120 missense possibly damaging 0.90
R4879:Pex5 UTSW 6 124398363 missense probably benign 0.02
R5068:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5069:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5339:Pex5 UTSW 6 124398004 missense probably benign 0.02
R6433:Pex5 UTSW 6 124413613 missense possibly damaging 0.81
R6825:Pex5 UTSW 6 124414381 missense probably damaging 0.98
R6851:Pex5 UTSW 6 124403154 missense possibly damaging 0.92
R7148:Pex5 UTSW 6 124405272 missense probably benign 0.10
R7286:Pex5 UTSW 6 124398063 nonsense probably null
R7673:Pex5 UTSW 6 124399383 missense probably damaging 0.98
R7752:Pex5 UTSW 6 124403901 missense probably damaging 0.99
R7793:Pex5 UTSW 6 124399341 missense probably benign 0.00
R8301:Pex5 UTSW 6 124405183 missense probably benign 0.02
Z1177:Pex5 UTSW 6 124398386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGATGTTGGACAGAGAAACG -3'
(R):5'- TGCGGCTTTACACAGACAAG -3'

Sequencing Primer
(F):5'- CTGATGTTGGACAGAGAAACGAAAAC -3'
(R):5'- GGCTTTACACAGACAAGGACTAC -3'
Posted On2019-11-26