Incidental Mutation 'R7752:Gpr4'
ID597296
Institutional Source Beutler Lab
Gene Symbol Gpr4
Ensembl Gene ENSMUSG00000044317
Gene NameG protein-coupled receptor 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19212538-19224174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19222415 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 87 (H87Q)
Ref Sequence ENSEMBL: ENSMUSP00000061243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060225]
Predicted Effect probably damaging
Transcript: ENSMUST00000060225
AA Change: H87Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061243
Gene: ENSMUSG00000044317
AA Change: H87Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 27 302 2.8e-6 PFAM
Pfam:7tm_1 36 288 2.9e-39 PFAM
low complexity region 330 341 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial neonatal and postnatal lethality, hemorrhages, impaired association of vascular smooth muscle cells with capillaries and small arteries and veins, and impaired contact between mesangial cells and renal glomerular capillaries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Gpr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1628:Gpr4 UTSW 7 19223199 missense probably benign
R1878:Gpr4 UTSW 7 19223124 missense probably damaging 1.00
R2094:Gpr4 UTSW 7 19222578 missense possibly damaging 0.58
R2117:Gpr4 UTSW 7 19223145 missense probably damaging 0.98
R4448:Gpr4 UTSW 7 19223001 missense probably damaging 1.00
R4705:Gpr4 UTSW 7 19222894 missense probably damaging 1.00
R6815:Gpr4 UTSW 7 19222635 missense probably damaging 0.98
R7191:Gpr4 UTSW 7 19223230 missense probably benign
R7196:Gpr4 UTSW 7 19223164 missense probably benign 0.10
R7733:Gpr4 UTSW 7 19222710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATCTTCGTCATCGGGGTG -3'
(R):5'- TCATCATGGAAGAGCGGTG -3'

Sequencing Primer
(F):5'- TCATCGGGGTGGGGCTG -3'
(R):5'- TGCTGAATTGGCGCCCAG -3'
Posted On2019-11-26