Incidental Mutation 'R7752:Tsg101'
ID597298
Institutional Source Beutler Lab
Gene Symbol Tsg101
Ensembl Gene ENSMUSG00000014402
Gene Nametumor susceptibility gene 101
SynonymsCC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location46888949-46919969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46913435 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 24 (Q24K)
Ref Sequence ENSEMBL: ENSMUSP00000014546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014546] [ENSMUST00000143413] [ENSMUST00000156335] [ENSMUST00000209538] [ENSMUST00000210664] [ENSMUST00000211076]
Predicted Effect probably benign
Transcript: ENSMUST00000014546
AA Change: Q24K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000014546
Gene: ENSMUSG00000014402
AA Change: Q24K

DomainStartEndE-ValueType
UBCc 22 177 5.96e-4 SMART
PDB:3IV1|H 229 305 1e-43 PDB
Pfam:Vps23_core 317 380 2.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143413
AA Change: Q24K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121314
Gene: ENSMUSG00000014402
AA Change: Q24K

DomainStartEndE-ValueType
UBCc 17 138 1.05e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156335
SMART Domains Protein: ENSMUSP00000120856
Gene: ENSMUSG00000014402

DomainStartEndE-ValueType
UBCc 51 206 5.96e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209538
Predicted Effect probably benign
Transcript: ENSMUST00000210664
AA Change: Q24K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000211076
AA Change: Q24K

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced growth, fail to form mesoderm, accumulate p53 protein and die by embryonic day 6.5. Homozygotes for a mammary gland-specific knockout show impaired mammogenesis and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Tsg101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Tsg101 APN 7 46908925 missense probably damaging 1.00
IGL01505:Tsg101 APN 7 46909060 missense probably damaging 1.00
R1183:Tsg101 UTSW 7 46889624 missense probably benign 0.23
R1558:Tsg101 UTSW 7 46889689 missense probably damaging 1.00
R1560:Tsg101 UTSW 7 46892460 splice site probably null
R1779:Tsg101 UTSW 7 46907087 missense probably benign 0.00
R2015:Tsg101 UTSW 7 46908904 critical splice donor site probably null
R2329:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R3773:Tsg101 UTSW 7 46889615 makesense probably null
R4108:Tsg101 UTSW 7 46892494 missense probably damaging 1.00
R4618:Tsg101 UTSW 7 46892509 missense possibly damaging 0.76
R5162:Tsg101 UTSW 7 46892426 missense probably damaging 1.00
R5380:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R5537:Tsg101 UTSW 7 46891128 missense probably benign 0.02
R6939:Tsg101 UTSW 7 46907099 missense probably benign 0.00
R7555:Tsg101 UTSW 7 46913411 missense probably damaging 1.00
R7901:Tsg101 UTSW 7 46913435 missense probably benign 0.01
R7951:Tsg101 UTSW 7 46891143 missense probably benign 0.38
R8052:Tsg101 UTSW 7 46892509 missense probably damaging 0.96
R8329:Tsg101 UTSW 7 46909060 missense probably damaging 1.00
X0063:Tsg101 UTSW 7 46889631 missense probably damaging 1.00
Z1177:Tsg101 UTSW 7 46890936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACCCTTCAGTTGGAAATCC -3'
(R):5'- AGGTCCCCTTAGGCTTTAATG -3'

Sequencing Primer
(F):5'- TGGAAATCCAACAAACTGCAAAGG -3'
(R):5'- GTGGTAGTTCACACTTTTAATCCCAG -3'
Posted On2019-11-26