Incidental Mutation 'R7752:Ddx6'
ID597304
Institutional Source Beutler Lab
Gene Symbol Ddx6
Ensembl Gene ENSMUSG00000032097
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 6
SynonymsmRCK/P54, HLR2, rck, C430015D01Rik, 1110001P04Rik, p54, E230023J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44604892-44640731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44627663 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 256 (F256C)
Ref Sequence ENSEMBL: ENSMUSP00000149620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170489] [ENSMUST00000217034]
Predicted Effect probably damaging
Transcript: ENSMUST00000170489
AA Change: F256C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128421
Gene: ENSMUSG00000032097
AA Change: F256C

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Blast:DEXDc 42 88 7e-18 BLAST
DEXDc 115 312 3.67e-52 SMART
HELICc 348 429 1.59e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217034
AA Change: F256C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The protein is an RNA helicase found in P-bodies and stress granules, and functions in translation suppression and mRNA degradation. It is required for microRNA-induced gene silencing. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Ddx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02561:Ddx6 APN 9 44634168 missense probably damaging 0.96
IGL02880:Ddx6 APN 9 44612897 splice site probably benign
R0278:Ddx6 UTSW 9 44631425 missense probably damaging 1.00
R1330:Ddx6 UTSW 9 44627773 splice site probably benign
R2001:Ddx6 UTSW 9 44607534 missense probably benign
R2002:Ddx6 UTSW 9 44607534 missense probably benign
R2124:Ddx6 UTSW 9 44624519 nonsense probably null
R2177:Ddx6 UTSW 9 44627731 missense probably damaging 1.00
R2347:Ddx6 UTSW 9 44607591 missense probably benign 0.00
R2863:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R2865:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R4584:Ddx6 UTSW 9 44624487 missense probably damaging 1.00
R4915:Ddx6 UTSW 9 44612873 missense probably damaging 1.00
R5476:Ddx6 UTSW 9 44607456 missense possibly damaging 0.67
R6213:Ddx6 UTSW 9 44628693 missense probably damaging 0.99
R6264:Ddx6 UTSW 9 44628752 missense probably damaging 1.00
R6368:Ddx6 UTSW 9 44635776 missense probably damaging 1.00
R6525:Ddx6 UTSW 9 44623629 missense probably damaging 1.00
R6994:Ddx6 UTSW 9 44628723 missense probably damaging 0.98
R7252:Ddx6 UTSW 9 44623753 splice site probably null
R7463:Ddx6 UTSW 9 44628729 missense probably damaging 1.00
R7706:Ddx6 UTSW 9 44627642 missense probably damaging 1.00
R7784:Ddx6 UTSW 9 44630142 critical splice donor site probably null
RF004:Ddx6 UTSW 9 44624492 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATGCACTGCTAGGGGTTGTC -3'
(R):5'- GCCTCAGAACAAGTAGAGGTC -3'

Sequencing Primer
(F):5'- CTGCTAGGGGTTGTCCTGGTAAC -3'
(R):5'- GAGACCTCTGTGAATTTGAAGCTAGC -3'
Posted On2019-11-26