Incidental Mutation 'R7752:Eme1'
ID597311
Institutional Source Beutler Lab
Gene Symbol Eme1
Ensembl Gene ENSMUSG00000039055
Gene Nameessential meiotic structure-specific endonuclease 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location94644996-94653964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94650819 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 59 (P59Q)
Ref Sequence ENSEMBL: ENSMUSP00000036361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025278] [ENSMUST00000039949]
Predicted Effect probably benign
Transcript: ENSMUST00000025278
SMART Domains Protein: ENSMUSP00000025278
Gene: ENSMUSG00000024414

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Ribosomal_L27 31 114 2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000039949
AA Change: P59Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036361
Gene: ENSMUSG00000039055
AA Change: P59Q

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ERCC4 252 515 2.06e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that complexes with methyl methanesulfonate-sensitive UV-sensitive 81 protein to form an endonuclease complex. The encoded protein interacts with specifc DNA structures including nicked Holliday junctions, 3'-flap structures and aberrant replication fork structures. This protein may be involved in repairing DNA damage and in maintaining genomic stability. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Eme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Eme1 APN 11 94645451 missense probably damaging 1.00
IGL02402:Eme1 APN 11 94650907 missense possibly damaging 0.65
R0220:Eme1 UTSW 11 94650258 missense probably null 1.00
R0594:Eme1 UTSW 11 94650430 missense possibly damaging 0.63
R0608:Eme1 UTSW 11 94650082 missense probably damaging 1.00
R0842:Eme1 UTSW 11 94650874 missense probably benign 0.24
R0925:Eme1 UTSW 11 94650732 missense probably damaging 0.99
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1161:Eme1 UTSW 11 94645542 missense probably damaging 1.00
R1310:Eme1 UTSW 11 94645542 missense probably damaging 1.00
R1837:Eme1 UTSW 11 94645961 missense probably benign 0.14
R2138:Eme1 UTSW 11 94648192 missense probably damaging 1.00
R2420:Eme1 UTSW 11 94645814 critical splice donor site probably null
R2427:Eme1 UTSW 11 94650975 unclassified probably benign
R3807:Eme1 UTSW 11 94650592 missense probably damaging 1.00
R4230:Eme1 UTSW 11 94647992 missense possibly damaging 0.69
R6889:Eme1 UTSW 11 94650477 missense probably benign 0.00
R7759:Eme1 UTSW 11 94645840 nonsense probably null
R7901:Eme1 UTSW 11 94650819 missense probably damaging 1.00
X0021:Eme1 UTSW 11 94650518 missense possibly damaging 0.56
Z1176:Eme1 UTSW 11 94650696 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GCGCTGGCATTATTTTGGCC -3'
(R):5'- AGCTCTAATGGGTTGATGGC -3'

Sequencing Primer
(F):5'- GCCATCCAAACCTGTTTTAAGTGAGG -3'
(R):5'- GATGGCTCTAAGAAGGTTATCCC -3'
Posted On2019-11-26