Incidental Mutation 'R7752:Farp1'
ID597322
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 121257947 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 605 (E605Q)
Ref Sequence ENSEMBL: ENSMUSP00000026635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635]
Predicted Effect probably damaging
Transcript: ENSMUST00000026635
AA Change: E605Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: E605Q

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1791:Farp1 UTSW 14 121256745 missense probably damaging 1.00
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R4988:Farp1 UTSW 14 121275607 missense probably damaging 1.00
R5379:Farp1 UTSW 14 121256757 missense possibly damaging 0.88
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5520:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5635:Farp1 UTSW 14 121276304 missense possibly damaging 0.96
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
R7469:Farp1 UTSW 14 121275421 missense probably damaging 1.00
R7549:Farp1 UTSW 14 121235177 missense possibly damaging 0.89
R7660:Farp1 UTSW 14 121276922 missense probably benign 0.00
R7788:Farp1 UTSW 14 121276253 missense probably benign 0.12
R7911:Farp1 UTSW 14 121242406 missense probably damaging 1.00
R8013:Farp1 UTSW 14 121242401 missense probably damaging 1.00
R8078:Farp1 UTSW 14 121276300 missense probably benign 0.04
R8113:Farp1 UTSW 14 121275596 missense probably benign 0.35
R8116:Farp1 UTSW 14 121233820 missense probably damaging 1.00
RF024:Farp1 UTSW 14 121237148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATCCCCAGTGTCTCAGG -3'
(R):5'- AAGAGTCCCCAGTCAAAGGC -3'

Sequencing Primer
(F):5'- AGTGTCTCAGGGCACAGC -3'
(R):5'- GAGTCCCCAGTCAAAGGCAAAAAG -3'
Posted On2019-11-26