Incidental Mutation 'R7752:Unkl'
ID597328
Institutional Source Beutler Lab
Gene Symbol Unkl
Ensembl Gene ENSMUSG00000015127
Gene Nameunkempt family like zinc finger
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25188397-25234443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25218653 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 200 (S200P)
Ref Sequence ENSEMBL: ENSMUSP00000124276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015271] [ENSMUST00000039734] [ENSMUST00000160896] [ENSMUST00000161679] [ENSMUST00000162498]
Predicted Effect probably benign
Transcript: ENSMUST00000015271
SMART Domains Protein: ENSMUSP00000015271
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
coiled coil region 73 154 N/A INTRINSIC
RING 198 232 4.13e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039734
AA Change: S386P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039670
Gene: ENSMUSG00000015127
AA Change: S386P

DomainStartEndE-ValueType
low complexity region 61 69 N/A INTRINSIC
ZnF_C3H1 76 103 1.33e-1 SMART
Blast:ZnF_C3H1 115 144 7e-13 BLAST
ZnF_C3H1 207 232 2.49e1 SMART
ZnF_C3H1 243 276 9.28e-1 SMART
ZnF_C3H1 285 312 8.47e-4 SMART
low complexity region 371 412 N/A INTRINSIC
low complexity region 463 495 N/A INTRINSIC
low complexity region 499 505 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
coiled coil region 561 642 N/A INTRINSIC
RING 686 720 4.13e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160896
AA Change: S200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124276
Gene: ENSMUSG00000015127
AA Change: S200P

DomainStartEndE-ValueType
ZnF_C3H1 21 46 2.49e1 SMART
ZnF_C3H1 57 90 9.28e-1 SMART
ZnF_C3H1 99 126 8.47e-4 SMART
low complexity region 185 226 N/A INTRINSIC
low complexity region 277 309 N/A INTRINSIC
low complexity region 313 319 N/A INTRINSIC
low complexity region 325 341 N/A INTRINSIC
coiled coil region 375 456 N/A INTRINSIC
RING 500 534 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161679
SMART Domains Protein: ENSMUSP00000125294
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 15 31 N/A INTRINSIC
coiled coil region 65 146 N/A INTRINSIC
RING 190 224 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162498
SMART Domains Protein: ENSMUSP00000124530
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 51 83 N/A INTRINSIC
low complexity region 87 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RING finger protein that may function in Rac signaling. It can bind to Brg/Brm-associated factor 60b and can promote its ubiquitination. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,101,860 I148T probably benign Het
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Unkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Unkl APN 17 25210848 missense probably benign 0.00
IGL02011:Unkl APN 17 25218591 missense probably damaging 1.00
IGL02141:Unkl APN 17 25229434 missense probably damaging 1.00
R0226:Unkl UTSW 17 25230711 missense probably damaging 0.96
R0394:Unkl UTSW 17 25230777 critical splice donor site probably null
R0638:Unkl UTSW 17 25208083 splice site probably benign
R1364:Unkl UTSW 17 25189623 missense probably benign
R1596:Unkl UTSW 17 25205733 missense probably null 1.00
R1899:Unkl UTSW 17 25229460 splice site probably null
R1960:Unkl UTSW 17 25209645 splice site probably benign
R3774:Unkl UTSW 17 25188407 splice site probably null
R3927:Unkl UTSW 17 25229329 missense probably damaging 0.99
R5164:Unkl UTSW 17 25213109 splice site probably null
R5481:Unkl UTSW 17 25201172 nonsense probably null
R5520:Unkl UTSW 17 25205610 missense probably damaging 1.00
R5559:Unkl UTSW 17 25205713 missense probably benign 0.00
R6267:Unkl UTSW 17 25231865 makesense probably null
R6296:Unkl UTSW 17 25231865 makesense probably null
R6883:Unkl UTSW 17 25230333 missense probably damaging 1.00
R6979:Unkl UTSW 17 25199916 missense probably damaging 1.00
R7901:Unkl UTSW 17 25218653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCCTGTTATGGTCAGTTC -3'
(R):5'- CTTTTCTACAGAGCAGCGCAG -3'

Sequencing Primer
(F):5'- CTCTGTGACACCTGAACTGTTGG -3'
(R):5'- CGCAGCCTGAACATCCAC -3'
Posted On2019-11-26