Incidental Mutation 'R0632:Akap6'
ID 59733
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene Name A kinase anchor protein 6
Synonyms
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.754) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 52746166-53202382 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52983931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 825 (N825I)
Ref Sequence ENSEMBL: ENSMUSP00000151871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
AlphaFold E9Q9K8
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: N825I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: N825I

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: N825I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2384 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53,187,763 (GRCm39) missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52,933,885 (GRCm39) missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52,984,000 (GRCm39) missense probably damaging 0.96
IGL01458:Akap6 APN 12 52,933,601 (GRCm39) nonsense probably null
IGL01589:Akap6 APN 12 53,186,447 (GRCm39) missense probably damaging 1.00
IGL01592:Akap6 APN 12 53,188,925 (GRCm39) missense probably damaging 1.00
IGL01738:Akap6 APN 12 52,933,600 (GRCm39) missense probably damaging 0.99
IGL01867:Akap6 APN 12 52,934,791 (GRCm39) missense probably damaging 1.00
IGL02025:Akap6 APN 12 53,187,118 (GRCm39) missense probably benign
IGL02041:Akap6 APN 12 53,187,436 (GRCm39) missense probably damaging 1.00
IGL02058:Akap6 APN 12 53,187,338 (GRCm39) missense probably damaging 1.00
IGL02194:Akap6 APN 12 52,933,606 (GRCm39) missense probably benign 0.00
IGL02226:Akap6 APN 12 53,057,250 (GRCm39) splice site probably benign
IGL02323:Akap6 APN 12 53,187,212 (GRCm39) missense probably benign 0.00
IGL02449:Akap6 APN 12 53,186,971 (GRCm39) missense probably damaging 1.00
IGL02475:Akap6 APN 12 53,186,277 (GRCm39) missense probably benign 0.03
IGL02546:Akap6 APN 12 52,927,521 (GRCm39) missense probably damaging 1.00
IGL02547:Akap6 APN 12 53,187,479 (GRCm39) missense probably damaging 1.00
IGL02588:Akap6 APN 12 52,933,282 (GRCm39) nonsense probably null
IGL02608:Akap6 APN 12 53,057,389 (GRCm39) missense probably benign 0.39
IGL02884:Akap6 APN 12 52,933,405 (GRCm39) missense probably benign 0.00
IGL02945:Akap6 APN 12 52,927,620 (GRCm39) missense probably damaging 1.00
IGL03029:Akap6 APN 12 52,933,195 (GRCm39) missense probably damaging 1.00
IGL03129:Akap6 APN 12 53,187,089 (GRCm39) missense probably damaging 1.00
R0133:Akap6 UTSW 12 53,186,254 (GRCm39) nonsense probably null
R0166:Akap6 UTSW 12 53,187,707 (GRCm39) missense probably benign 0.04
R0189:Akap6 UTSW 12 53,188,037 (GRCm39) missense probably benign 0.41
R0532:Akap6 UTSW 12 52,934,766 (GRCm39) missense probably benign 0.00
R0666:Akap6 UTSW 12 52,958,591 (GRCm39) missense probably damaging 1.00
R0723:Akap6 UTSW 12 53,188,685 (GRCm39) missense probably damaging 1.00
R0763:Akap6 UTSW 12 53,188,997 (GRCm39) missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52,933,405 (GRCm39) missense probably benign 0.00
R0879:Akap6 UTSW 12 52,927,582 (GRCm39) missense probably damaging 1.00
R0880:Akap6 UTSW 12 53,186,291 (GRCm39) missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53,116,005 (GRCm39) missense probably damaging 0.97
R1055:Akap6 UTSW 12 52,927,455 (GRCm39) nonsense probably null
R1199:Akap6 UTSW 12 52,842,973 (GRCm39) missense probably damaging 1.00
R1295:Akap6 UTSW 12 52,933,812 (GRCm39) missense probably damaging 1.00
R1389:Akap6 UTSW 12 53,186,303 (GRCm39) missense probably benign 0.15
R1471:Akap6 UTSW 12 53,188,279 (GRCm39) missense probably benign 0.05
R1483:Akap6 UTSW 12 52,842,870 (GRCm39) missense probably damaging 1.00
R1512:Akap6 UTSW 12 52,983,937 (GRCm39) missense probably damaging 1.00
R1648:Akap6 UTSW 12 53,188,789 (GRCm39) nonsense probably null
R1791:Akap6 UTSW 12 53,115,908 (GRCm39) missense probably damaging 1.00
R1888:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53,188,635 (GRCm39) missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53,151,395 (GRCm39) missense probably benign 0.13
R1970:Akap6 UTSW 12 52,985,258 (GRCm39) missense probably damaging 0.96
R1987:Akap6 UTSW 12 53,187,578 (GRCm39) missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53,187,578 (GRCm39) missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53,188,187 (GRCm39) missense probably benign 0.03
R2567:Akap6 UTSW 12 52,985,156 (GRCm39) missense probably damaging 1.00
R2568:Akap6 UTSW 12 52,934,061 (GRCm39) missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53,186,926 (GRCm39) missense probably benign
R3051:Akap6 UTSW 12 52,933,816 (GRCm39) missense probably damaging 1.00
R3195:Akap6 UTSW 12 53,119,240 (GRCm39) nonsense probably null
R3196:Akap6 UTSW 12 53,119,240 (GRCm39) nonsense probably null
R3426:Akap6 UTSW 12 52,934,817 (GRCm39) missense probably damaging 1.00
R3783:Akap6 UTSW 12 52,927,552 (GRCm39) missense probably damaging 1.00
R3934:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53,188,236 (GRCm39) missense probably damaging 1.00
R3970:Akap6 UTSW 12 53,188,236 (GRCm39) missense probably damaging 1.00
R4042:Akap6 UTSW 12 53,186,162 (GRCm39) critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53,186,245 (GRCm39) missense probably damaging 1.00
R4152:Akap6 UTSW 12 53,187,190 (GRCm39) missense probably benign 0.45
R4231:Akap6 UTSW 12 53,187,821 (GRCm39) missense probably damaging 1.00
R4232:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4233:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4234:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4235:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4236:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4475:Akap6 UTSW 12 53,188,426 (GRCm39) missense probably benign 0.00
R4513:Akap6 UTSW 12 52,842,787 (GRCm39) missense probably benign 0.03
R4686:Akap6 UTSW 12 52,934,406 (GRCm39) frame shift probably null
R4724:Akap6 UTSW 12 52,842,668 (GRCm39) missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52,934,406 (GRCm39) frame shift probably null
R4852:Akap6 UTSW 12 53,151,458 (GRCm39) missense probably damaging 1.00
R5024:Akap6 UTSW 12 53,189,345 (GRCm39) missense probably benign 0.01
R5116:Akap6 UTSW 12 53,188,298 (GRCm39) missense probably benign 0.01
R5164:Akap6 UTSW 12 53,189,249 (GRCm39) missense probably benign
R5225:Akap6 UTSW 12 52,933,329 (GRCm39) missense probably damaging 1.00
R5269:Akap6 UTSW 12 53,186,626 (GRCm39) missense probably damaging 0.99
R5352:Akap6 UTSW 12 52,842,880 (GRCm39) missense probably damaging 1.00
R5496:Akap6 UTSW 12 53,187,436 (GRCm39) missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52,842,747 (GRCm39) missense probably damaging 1.00
R5997:Akap6 UTSW 12 52,984,016 (GRCm39) critical splice donor site probably null
R6137:Akap6 UTSW 12 53,187,137 (GRCm39) missense probably damaging 1.00
R6151:Akap6 UTSW 12 53,072,575 (GRCm39) missense probably damaging 1.00
R6169:Akap6 UTSW 12 53,189,141 (GRCm39) missense probably benign
R6307:Akap6 UTSW 12 53,188,351 (GRCm39) missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53,188,808 (GRCm39) missense probably damaging 0.98
R6479:Akap6 UTSW 12 53,187,952 (GRCm39) missense probably damaging 1.00
R6502:Akap6 UTSW 12 53,186,998 (GRCm39) missense probably damaging 1.00
R6760:Akap6 UTSW 12 53,186,561 (GRCm39) missense probably damaging 1.00
R6778:Akap6 UTSW 12 53,072,599 (GRCm39) missense probably damaging 1.00
R6837:Akap6 UTSW 12 53,188,045 (GRCm39) missense probably damaging 1.00
R6896:Akap6 UTSW 12 52,934,277 (GRCm39) missense probably benign 0.06
R6917:Akap6 UTSW 12 53,115,951 (GRCm39) missense probably null 0.97
R6983:Akap6 UTSW 12 52,934,436 (GRCm39) missense probably damaging 1.00
R7142:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7143:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7216:Akap6 UTSW 12 53,187,240 (GRCm39) missense probably benign 0.02
R7297:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7356:Akap6 UTSW 12 52,958,647 (GRCm39) missense probably damaging 1.00
R7378:Akap6 UTSW 12 53,189,357 (GRCm39) missense probably benign 0.00
R7382:Akap6 UTSW 12 53,188,954 (GRCm39) missense probably benign 0.00
R7498:Akap6 UTSW 12 53,189,488 (GRCm39) nonsense probably null
R7542:Akap6 UTSW 12 53,116,017 (GRCm39) missense probably damaging 1.00
R7589:Akap6 UTSW 12 53,188,846 (GRCm39) nonsense probably null
R7676:Akap6 UTSW 12 52,933,633 (GRCm39) missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53,187,744 (GRCm39) missense probably benign 0.28
R7971:Akap6 UTSW 12 53,186,578 (GRCm39) missense probably damaging 1.00
R8039:Akap6 UTSW 12 53,188,459 (GRCm39) missense probably benign 0.00
R8425:Akap6 UTSW 12 52,933,404 (GRCm39) missense probably benign 0.00
R8747:Akap6 UTSW 12 53,188,999 (GRCm39) missense probably benign 0.01
R8885:Akap6 UTSW 12 53,188,319 (GRCm39) missense probably benign
R8956:Akap6 UTSW 12 53,187,127 (GRCm39) missense probably benign 0.00
R8989:Akap6 UTSW 12 52,927,654 (GRCm39) missense probably damaging 1.00
R9014:Akap6 UTSW 12 53,186,403 (GRCm39) missense possibly damaging 0.60
R9031:Akap6 UTSW 12 53,188,831 (GRCm39) missense probably benign 0.36
R9216:Akap6 UTSW 12 52,927,668 (GRCm39) missense probably benign 0.05
R9220:Akap6 UTSW 12 53,187,232 (GRCm39) missense possibly damaging 0.49
R9243:Akap6 UTSW 12 53,188,035 (GRCm39) missense probably benign 0.08
R9286:Akap6 UTSW 12 53,119,254 (GRCm39) missense possibly damaging 0.90
R9347:Akap6 UTSW 12 53,115,894 (GRCm39) missense probably damaging 1.00
R9475:Akap6 UTSW 12 53,057,335 (GRCm39) missense probably damaging 1.00
R9509:Akap6 UTSW 12 53,189,021 (GRCm39) missense probably damaging 0.99
R9523:Akap6 UTSW 12 52,842,672 (GRCm39) missense probably benign 0.02
R9600:Akap6 UTSW 12 52,933,341 (GRCm39) missense probably benign 0.04
R9612:Akap6 UTSW 12 52,958,690 (GRCm39) missense probably damaging 1.00
R9627:Akap6 UTSW 12 53,151,413 (GRCm39) missense
R9666:Akap6 UTSW 12 53,188,318 (GRCm39) missense probably benign
R9784:Akap6 UTSW 12 53,187,853 (GRCm39) missense probably damaging 1.00
X0062:Akap6 UTSW 12 53,189,144 (GRCm39) missense probably benign 0.43
Z1176:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CGAGCAGTTTCCAAACAGATGCAC -3'
(R):5'- CGGATGGCAAGCCCCAAATAAAATG -3'

Sequencing Primer
(F):5'- GATGCACTCTGCTAGTCTAACAG -3'
(R):5'- ACAGACCGTTTGGAGGC -3'
Posted On 2013-07-11