Incidental Mutation 'R0632:Akap6'
ID 59733
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene Name A kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.843) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 52699383-53155599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52937148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 825 (N825I)
Ref Sequence ENSEMBL: ENSMUSP00000151871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
AlphaFold E9Q9K8
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: N825I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: N825I

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: N825I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2384 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Art5 G A 7: 102,097,957 T205I probably damaging Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
C8a T C 4: 104,856,492 D147G probably damaging Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cfap54 C T 10: 92,885,096 E2543K unknown Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Ctsh A G 9: 90,061,582 R87G possibly damaging Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hist1h4i G T 13: 22,041,027 Y99* probably null Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Klk1b9 G T 7: 43,979,372 G100V possibly damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mcub T C 3: 129,918,726 M167V probably benign Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr652 A G 7: 104,564,337 I39V probably benign Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Vsig10l T G 7: 43,464,137 V171G probably damaging Het
Zfp957 T A 14: 79,212,920 I480F probably damaging Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
R7142:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7143:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7216:Akap6 UTSW 12 53140457 missense probably benign 0.02
R7297:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7356:Akap6 UTSW 12 52911864 missense probably damaging 1.00
R7378:Akap6 UTSW 12 53142574 missense probably benign 0.00
R7382:Akap6 UTSW 12 53142171 missense probably benign 0.00
R7498:Akap6 UTSW 12 53142705 nonsense probably null
R7542:Akap6 UTSW 12 53069234 missense probably damaging 1.00
R7589:Akap6 UTSW 12 53142063 nonsense probably null
R7676:Akap6 UTSW 12 52886850 missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53140961 missense probably benign 0.28
R7971:Akap6 UTSW 12 53139795 missense probably damaging 1.00
R8039:Akap6 UTSW 12 53141676 missense probably benign 0.00
R8425:Akap6 UTSW 12 52886621 missense probably benign 0.00
R8747:Akap6 UTSW 12 53142216 missense probably benign 0.01
R8885:Akap6 UTSW 12 53141536 missense probably benign
R8956:Akap6 UTSW 12 53140344 missense probably benign 0.00
R8989:Akap6 UTSW 12 52880871 missense probably damaging 1.00
R9014:Akap6 UTSW 12 53139620 missense possibly damaging 0.60
R9031:Akap6 UTSW 12 53142048 missense probably benign 0.36
R9216:Akap6 UTSW 12 52880885 missense probably benign 0.05
R9220:Akap6 UTSW 12 53140449 missense possibly damaging 0.49
R9243:Akap6 UTSW 12 53141252 missense probably benign 0.08
R9286:Akap6 UTSW 12 53072471 missense possibly damaging 0.90
R9347:Akap6 UTSW 12 53069111 missense probably damaging 1.00
R9475:Akap6 UTSW 12 53010552 missense probably damaging 1.00
R9509:Akap6 UTSW 12 53142238 missense probably damaging 0.99
R9523:Akap6 UTSW 12 52795889 missense probably benign 0.02
R9600:Akap6 UTSW 12 52886558 missense probably benign 0.04
R9612:Akap6 UTSW 12 52911907 missense probably damaging 1.00
R9627:Akap6 UTSW 12 53104630 missense
R9666:Akap6 UTSW 12 53141535 missense probably benign
R9784:Akap6 UTSW 12 53141070 missense probably damaging 1.00
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Z1176:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CGAGCAGTTTCCAAACAGATGCAC -3'
(R):5'- CGGATGGCAAGCCCCAAATAAAATG -3'

Sequencing Primer
(F):5'- GATGCACTCTGCTAGTCTAACAG -3'
(R):5'- ACAGACCGTTTGGAGGC -3'
Posted On 2013-07-11