Incidental Mutation 'R7752:1700017D01Rik'
ID597331
Institutional Source Beutler Lab
Gene Symbol 1700017D01Rik
Ensembl Gene ENSMUSG00000024729
Gene NameRIKEN cDNA 1700017D01 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7752 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location11096816-11130876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11101860 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 148 (I148T)
Ref Sequence ENSEMBL: ENSMUSP00000025635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025635]
Predicted Effect probably benign
Transcript: ENSMUST00000025635
AA Change: I148T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025635
Gene: ENSMUSG00000024729
AA Change: I148T

DomainStartEndE-ValueType
Pfam:CD20 18 118 2.4e-8 PFAM
transmembrane domain 130 152 N/A INTRINSIC
low complexity region 169 185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Akap13 T A 7: 75,677,258 N668K possibly damaging Het
Aox4 G A 1: 58,253,948 V868I not run Het
Ccdc39 T C 3: 33,832,617 R281G possibly damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cfhr2 T A 1: 139,813,584 I218F probably damaging Het
Clcn4 T C 7: 7,293,937 K234R probably benign Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Dcp1b G T 6: 119,175,357 R22L possibly damaging Het
Ddx6 T G 9: 44,627,663 F256C probably damaging Het
Diras1 C T 10: 81,022,061 V119M probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Farp1 G C 14: 121,257,947 E605Q probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gcn1l1 T A 5: 115,615,568 L2326Q probably damaging Het
Gm10436 T C 12: 88,175,999 E478G probably damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gpr4 C A 7: 19,222,415 H87Q probably damaging Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Inf2 A G 12: 112,609,684 E865G unknown Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Lcmt1 G T 7: 123,369,807 M8I unknown Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc4 A G 16: 32,768,734 Y755C Het
Ncoa3 T A 2: 166,065,768 L1099* probably null Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr356 A T 2: 36,937,618 L166F probably damaging Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Pex5 A G 6: 124,403,901 S255P probably damaging Het
Pex5 T C 6: 124,414,018 T58A probably benign Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppl T G 16: 5,102,302 S410R probably benign Het
Ppp1r17 G A 6: 56,022,456 D25N probably damaging Het
Prox2 T A 12: 85,088,041 I489F probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc41a2 A G 10: 83,256,041 S453P possibly damaging Het
Sox11 A T 12: 27,341,440 N323K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thbd C A 2: 148,406,974 V325L probably damaging Het
Tmco5 T C 2: 116,892,262 F288S probably damaging Het
Traj16 T C 14: 54,203,188 Y19H unknown Het
Trip11 A G 12: 101,886,974 V454A probably benign Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttn T C 2: 76,725,026 E30545G probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Vwa2 T A 19: 56,909,240 I659N probably damaging Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in 1700017D01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:1700017D01Rik APN 19 11110331 nonsense probably null
IGL02182:1700017D01Rik APN 19 11097072 splice site probably benign
IGL03156:1700017D01Rik APN 19 11105750 missense possibly damaging 0.80
R0189:1700017D01Rik UTSW 19 11096947 missense possibly damaging 0.46
R0218:1700017D01Rik UTSW 19 11116437 nonsense probably null
R0464:1700017D01Rik UTSW 19 11112437 missense probably damaging 1.00
R0617:1700017D01Rik UTSW 19 11112400 missense probably damaging 1.00
R1171:1700017D01Rik UTSW 19 11112377 missense probably damaging 0.97
R2341:1700017D01Rik UTSW 19 11105793 missense probably benign
R5099:1700017D01Rik UTSW 19 11112461 critical splice acceptor site probably null
R5330:1700017D01Rik UTSW 19 11091858 unclassified probably benign
R5331:1700017D01Rik UTSW 19 11091858 unclassified probably benign
R5341:1700017D01Rik UTSW 19 11110381 intron probably benign
R6109:1700017D01Rik UTSW 19 11101912 missense possibly damaging 0.66
R6177:1700017D01Rik UTSW 19 11105750 missense possibly damaging 0.53
R6970:1700017D01Rik UTSW 19 11112314 critical splice donor site probably null
R7038:1700017D01Rik UTSW 19 11110311 missense probably benign
R7584:1700017D01Rik UTSW 19 11110361 missense possibly damaging 0.94
R7854:1700017D01Rik UTSW 19 11112377 missense probably benign 0.01
R8261:1700017D01Rik UTSW 19 11110343 missense probably damaging 0.97
X0019:1700017D01Rik UTSW 19 11105792 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCTCTGCCACAGACACCTG -3'
(R):5'- GATTCACTTCATAAACAGGGAAGC -3'

Sequencing Primer
(F):5'- AGACACCTGCTACCATATGC -3'
(R):5'- TCATAAACAGGGAAGCAACTAACTTG -3'
Posted On2019-11-26