Incidental Mutation 'R7753:Or5m5'
ID 597343
Institutional Source Beutler Lab
Gene Symbol Or5m5
Ensembl Gene ENSMUSG00000044923
Gene Name olfactory receptor family 5 subfamily M member 5
Synonyms MOR196-2, Olfr1030, GA_x6K02T2Q125-47462755-47463693
MMRRC Submission 045809-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7753 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 85809656-85815142 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85815060 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 292 (N292S)
Ref Sequence ENSEMBL: ENSMUSP00000053309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056849]
AlphaFold Q8VFL5
Predicted Effect possibly damaging
Transcript: ENSMUST00000056849
AA Change: N292S

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923
AA Change: N292S

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,074,933 (GRCm39) T1377A probably damaging Het
AI661453 G T 17: 47,778,439 (GRCm39) E722* probably null Het
Ap2b1 A T 11: 83,258,733 (GRCm39) K735* probably null Het
Aqp4 T C 18: 15,533,033 (GRCm39) E20G probably benign Het
Atp6v1b1 G T 6: 83,729,440 (GRCm39) V117L probably benign Het
C1rb A G 6: 124,557,390 (GRCm39) N509S probably benign Het
Cep44 A G 8: 56,985,842 (GRCm39) V350A probably benign Het
Cmya5 T C 13: 93,234,680 (GRCm39) Q136R probably benign Het
Cntrl T C 2: 35,001,691 (GRCm39) S32P probably damaging Het
Cyp2d12 A T 15: 82,441,164 (GRCm39) E201V possibly damaging Het
Cyp4a14 G T 4: 115,350,861 (GRCm39) Q138K probably damaging Het
Dapk1 T C 13: 60,899,007 (GRCm39) Y826H possibly damaging Het
Dbh A G 2: 27,061,448 (GRCm39) D294G probably benign Het
Ddx10 A T 9: 53,136,904 (GRCm39) L336Q probably damaging Het
Dop1a A G 9: 86,371,755 (GRCm39) T149A possibly damaging Het
Epg5 A G 18: 77,991,560 (GRCm39) T86A possibly damaging Het
Fam171a1 A T 2: 3,179,354 (GRCm39) Q60L probably damaging Het
Farsb T A 1: 78,456,740 (GRCm39) E41D probably benign Het
Frem1 T C 4: 82,832,217 (GRCm39) D1956G probably benign Het
Fzd4 T A 7: 89,056,992 (GRCm39) Y346* probably null Het
Fzd7 A T 1: 59,522,641 (GRCm39) S175C probably benign Het
Gdi2 A G 13: 3,598,956 (GRCm39) T47A probably benign Het
Gpr155 A T 2: 73,212,550 (GRCm39) H24Q probably benign Het
Hdac7 A T 15: 97,698,642 (GRCm39) N638K possibly damaging Het
Hdac7 G T 15: 97,704,369 (GRCm39) N515K probably benign Het
Hnrnpul2 T C 19: 8,802,336 (GRCm39) V401A probably damaging Het
Ifi27l2b T A 12: 103,417,519 (GRCm39) R223* probably null Het
Igkv4-91 T G 6: 68,745,761 (GRCm39) S46R probably benign Het
Itk T A 11: 46,222,722 (GRCm39) L582F probably damaging Het
Kcnab2 T C 4: 152,481,218 (GRCm39) I181V probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC GCCACAGCCTCC 7: 141,729,136 (GRCm39) probably benign Het
Lce1m C A 3: 92,925,815 (GRCm39) G41W unknown Het
Mapk10 T A 5: 103,186,419 (GRCm39) K98* probably null Het
Mapk8ip2 A G 15: 89,345,856 (GRCm39) E812G probably damaging Het
Mlh1 C A 9: 111,081,931 (GRCm39) probably null Het
Mroh1 A G 15: 76,317,475 (GRCm39) D784G possibly damaging Het
Neo1 A T 9: 58,863,288 (GRCm39) D426E probably benign Het
Nol4 T A 18: 23,171,659 (GRCm39) M1L probably benign Het
Nr1h3 A G 2: 91,015,370 (GRCm39) F338S probably damaging Het
Oasl2 A G 5: 115,043,118 (GRCm39) K297E probably benign Het
Or10ag59 A G 2: 87,406,141 (GRCm39) T238A probably benign Het
Or10z1 C T 1: 174,078,236 (GRCm39) V86I probably benign Het
Or4f14 A G 2: 111,742,927 (GRCm39) I116T probably benign Het
Or56a5 T C 7: 104,793,007 (GRCm39) I164M probably benign Het
Osbpl9 T C 4: 108,990,970 (GRCm39) T97A possibly damaging Het
P3h2 A T 16: 25,789,687 (GRCm39) Y527N probably damaging Het
Papss2 A T 19: 32,597,579 (GRCm39) H9L probably benign Het
Pcdha4 C A 18: 37,086,354 (GRCm39) S179Y possibly damaging Het
Ppt1 A T 4: 122,730,131 (GRCm39) D28V possibly damaging Het
Prkcz T A 4: 155,357,425 (GRCm39) Q345L possibly damaging Het
Prr14l G T 5: 32,984,597 (GRCm39) L1633I probably damaging Het
Prss51 T A 14: 64,333,376 (GRCm39) V13D possibly damaging Het
Qrich2 TTGCAACACACCAGGCTGAACTGGACCTTGCTG TTG 11: 116,347,868 (GRCm39) probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Slc2a7 T C 4: 150,239,141 (GRCm39) I122T possibly damaging Het
Spata31e4 A T 13: 50,855,817 (GRCm39) D485V probably damaging Het
Sprr3 G A 3: 92,364,415 (GRCm39) P143L probably benign Het
Sugct A T 13: 17,752,104 (GRCm39) S181T possibly damaging Het
Syne2 G A 12: 76,085,697 (GRCm39) R141Q probably benign Het
Taok1 T C 11: 77,428,725 (GRCm39) I992V probably benign Het
Tbc1d21 A C 9: 58,269,306 (GRCm39) probably null Het
Thada T C 17: 84,559,818 (GRCm39) D1453G probably damaging Het
Thoc5 T C 11: 4,852,156 (GRCm39) L104S probably damaging Het
Tln2 T G 9: 67,302,755 (GRCm39) Y72S probably damaging Het
Tmem98 A G 11: 80,705,137 (GRCm39) E75G probably damaging Het
Tox3 A G 8: 90,975,560 (GRCm39) L357P probably damaging Het
Ubr4 T C 4: 139,197,603 (GRCm39) V4492A unknown Het
Ulk4 A G 9: 121,095,578 (GRCm39) probably null Het
Ush2a A G 1: 188,175,603 (GRCm39) T1234A probably benign Het
Usp53 G A 3: 122,742,887 (GRCm39) T683I probably damaging Het
Vcan T A 13: 89,837,442 (GRCm39) I2701F probably damaging Het
Vmn2r72 G A 7: 85,399,834 (GRCm39) A405V probably damaging Het
Vmn2r96 A T 17: 18,806,663 (GRCm39) T537S possibly damaging Het
Vstm2a G T 11: 16,213,040 (GRCm39) A142S probably damaging Het
Zbtb41 A G 1: 139,374,895 (GRCm39) D785G probably benign Het
Zfp397 A T 18: 24,090,129 (GRCm39) Q144H probably benign Het
Zfp518a A T 19: 40,904,249 (GRCm39) T1393S possibly damaging Het
Other mutations in Or5m5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Or5m5 APN 2 85,815,014 (GRCm39) missense probably damaging 0.99
IGL01795:Or5m5 APN 2 85,814,478 (GRCm39) missense probably damaging 1.00
IGL02395:Or5m5 APN 2 85,814,426 (GRCm39) missense possibly damaging 0.76
IGL03277:Or5m5 APN 2 85,814,517 (GRCm39) missense probably damaging 0.99
PIT4468001:Or5m5 UTSW 2 85,814,792 (GRCm39) missense probably benign 0.10
R0458:Or5m5 UTSW 2 85,814,600 (GRCm39) missense probably benign 0.00
R1114:Or5m5 UTSW 2 85,814,651 (GRCm39) missense probably benign
R1642:Or5m5 UTSW 2 85,814,201 (GRCm39) missense probably benign 0.00
R2189:Or5m5 UTSW 2 85,814,412 (GRCm39) missense probably damaging 1.00
R4094:Or5m5 UTSW 2 85,814,562 (GRCm39) missense probably damaging 1.00
R4246:Or5m5 UTSW 2 85,814,624 (GRCm39) missense possibly damaging 0.90
R4677:Or5m5 UTSW 2 85,814,315 (GRCm39) missense possibly damaging 0.61
R5537:Or5m5 UTSW 2 85,814,570 (GRCm39) missense possibly damaging 0.83
R6018:Or5m5 UTSW 2 85,815,148 (GRCm39) utr 3 prime probably benign
R6531:Or5m5 UTSW 2 85,814,651 (GRCm39) missense probably benign
R7367:Or5m5 UTSW 2 85,814,687 (GRCm39) missense possibly damaging 0.68
R7611:Or5m5 UTSW 2 85,814,407 (GRCm39) nonsense probably null
R7693:Or5m5 UTSW 2 85,814,979 (GRCm39) missense probably damaging 1.00
R8940:Or5m5 UTSW 2 85,814,543 (GRCm39) missense probably benign
R8961:Or5m5 UTSW 2 85,814,610 (GRCm39) missense probably damaging 1.00
R9049:Or5m5 UTSW 2 85,814,235 (GRCm39) missense possibly damaging 0.49
R9202:Or5m5 UTSW 2 85,814,801 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGCGTTCTGCTGAAGGTAG -3'
(R):5'- ACACATGCATTTTACTTCCTCACAG -3'

Sequencing Primer
(F):5'- CTGCTGAAGGTAGGCGCAAAG -3'
(R):5'- TTTACTTCCTCACAGTATGCAAAC -3'
Posted On 2019-11-26