Incidental Mutation 'R7753:Lce1m'
ID 597348
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Name late cornified envelope 1M
Synonyms 1110059L13Rik, Sprrl10, Lce5a
MMRRC Submission 045809-MU
Accession Numbers
Essential gene? Not available question?
Stock # R7753 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 92925117-92926367 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 92925815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 41 (G41W)
Ref Sequence ENSEMBL: ENSMUSP00000029520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
AlphaFold Q9CR91
Predicted Effect unknown
Transcript: ENSMUST00000029520
AA Change: G41W
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912
AA Change: G41W

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect silent
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,074,933 (GRCm39) T1377A probably damaging Het
AI661453 G T 17: 47,778,439 (GRCm39) E722* probably null Het
Ap2b1 A T 11: 83,258,733 (GRCm39) K735* probably null Het
Aqp4 T C 18: 15,533,033 (GRCm39) E20G probably benign Het
Atp6v1b1 G T 6: 83,729,440 (GRCm39) V117L probably benign Het
C1rb A G 6: 124,557,390 (GRCm39) N509S probably benign Het
Cep44 A G 8: 56,985,842 (GRCm39) V350A probably benign Het
Cmya5 T C 13: 93,234,680 (GRCm39) Q136R probably benign Het
Cntrl T C 2: 35,001,691 (GRCm39) S32P probably damaging Het
Cyp2d12 A T 15: 82,441,164 (GRCm39) E201V possibly damaging Het
Cyp4a14 G T 4: 115,350,861 (GRCm39) Q138K probably damaging Het
Dapk1 T C 13: 60,899,007 (GRCm39) Y826H possibly damaging Het
Dbh A G 2: 27,061,448 (GRCm39) D294G probably benign Het
Ddx10 A T 9: 53,136,904 (GRCm39) L336Q probably damaging Het
Dop1a A G 9: 86,371,755 (GRCm39) T149A possibly damaging Het
Epg5 A G 18: 77,991,560 (GRCm39) T86A possibly damaging Het
Fam171a1 A T 2: 3,179,354 (GRCm39) Q60L probably damaging Het
Farsb T A 1: 78,456,740 (GRCm39) E41D probably benign Het
Frem1 T C 4: 82,832,217 (GRCm39) D1956G probably benign Het
Fzd4 T A 7: 89,056,992 (GRCm39) Y346* probably null Het
Fzd7 A T 1: 59,522,641 (GRCm39) S175C probably benign Het
Gdi2 A G 13: 3,598,956 (GRCm39) T47A probably benign Het
Gpr155 A T 2: 73,212,550 (GRCm39) H24Q probably benign Het
Hdac7 A T 15: 97,698,642 (GRCm39) N638K possibly damaging Het
Hdac7 G T 15: 97,704,369 (GRCm39) N515K probably benign Het
Hnrnpul2 T C 19: 8,802,336 (GRCm39) V401A probably damaging Het
Ifi27l2b T A 12: 103,417,519 (GRCm39) R223* probably null Het
Igkv4-91 T G 6: 68,745,761 (GRCm39) S46R probably benign Het
Itk T A 11: 46,222,722 (GRCm39) L582F probably damaging Het
Kcnab2 T C 4: 152,481,218 (GRCm39) I181V probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC GCCACAGCCTCC 7: 141,729,136 (GRCm39) probably benign Het
Mapk10 T A 5: 103,186,419 (GRCm39) K98* probably null Het
Mapk8ip2 A G 15: 89,345,856 (GRCm39) E812G probably damaging Het
Mlh1 C A 9: 111,081,931 (GRCm39) probably null Het
Mroh1 A G 15: 76,317,475 (GRCm39) D784G possibly damaging Het
Neo1 A T 9: 58,863,288 (GRCm39) D426E probably benign Het
Nol4 T A 18: 23,171,659 (GRCm39) M1L probably benign Het
Nr1h3 A G 2: 91,015,370 (GRCm39) F338S probably damaging Het
Oasl2 A G 5: 115,043,118 (GRCm39) K297E probably benign Het
Or10ag59 A G 2: 87,406,141 (GRCm39) T238A probably benign Het
Or10z1 C T 1: 174,078,236 (GRCm39) V86I probably benign Het
Or4f14 A G 2: 111,742,927 (GRCm39) I116T probably benign Het
Or56a5 T C 7: 104,793,007 (GRCm39) I164M probably benign Het
Or5m5 A G 2: 85,815,060 (GRCm39) N292S possibly damaging Het
Osbpl9 T C 4: 108,990,970 (GRCm39) T97A possibly damaging Het
P3h2 A T 16: 25,789,687 (GRCm39) Y527N probably damaging Het
Papss2 A T 19: 32,597,579 (GRCm39) H9L probably benign Het
Pcdha4 C A 18: 37,086,354 (GRCm39) S179Y possibly damaging Het
Ppt1 A T 4: 122,730,131 (GRCm39) D28V possibly damaging Het
Prkcz T A 4: 155,357,425 (GRCm39) Q345L possibly damaging Het
Prr14l G T 5: 32,984,597 (GRCm39) L1633I probably damaging Het
Prss51 T A 14: 64,333,376 (GRCm39) V13D possibly damaging Het
Qrich2 TTGCAACACACCAGGCTGAACTGGACCTTGCTG TTG 11: 116,347,868 (GRCm39) probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Slc2a7 T C 4: 150,239,141 (GRCm39) I122T possibly damaging Het
Spata31e4 A T 13: 50,855,817 (GRCm39) D485V probably damaging Het
Sprr3 G A 3: 92,364,415 (GRCm39) P143L probably benign Het
Sugct A T 13: 17,752,104 (GRCm39) S181T possibly damaging Het
Syne2 G A 12: 76,085,697 (GRCm39) R141Q probably benign Het
Taok1 T C 11: 77,428,725 (GRCm39) I992V probably benign Het
Tbc1d21 A C 9: 58,269,306 (GRCm39) probably null Het
Thada T C 17: 84,559,818 (GRCm39) D1453G probably damaging Het
Thoc5 T C 11: 4,852,156 (GRCm39) L104S probably damaging Het
Tln2 T G 9: 67,302,755 (GRCm39) Y72S probably damaging Het
Tmem98 A G 11: 80,705,137 (GRCm39) E75G probably damaging Het
Tox3 A G 8: 90,975,560 (GRCm39) L357P probably damaging Het
Ubr4 T C 4: 139,197,603 (GRCm39) V4492A unknown Het
Ulk4 A G 9: 121,095,578 (GRCm39) probably null Het
Ush2a A G 1: 188,175,603 (GRCm39) T1234A probably benign Het
Usp53 G A 3: 122,742,887 (GRCm39) T683I probably damaging Het
Vcan T A 13: 89,837,442 (GRCm39) I2701F probably damaging Het
Vmn2r72 G A 7: 85,399,834 (GRCm39) A405V probably damaging Het
Vmn2r96 A T 17: 18,806,663 (GRCm39) T537S possibly damaging Het
Vstm2a G T 11: 16,213,040 (GRCm39) A142S probably damaging Het
Zbtb41 A G 1: 139,374,895 (GRCm39) D785G probably benign Het
Zfp397 A T 18: 24,090,129 (GRCm39) Q144H probably benign Het
Zfp518a A T 19: 40,904,249 (GRCm39) T1393S possibly damaging Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 92,925,554 (GRCm39) unclassified probably benign
FR4449:Lce1m UTSW 3 92,925,459 (GRCm39) unclassified probably benign
FR4589:Lce1m UTSW 3 92,925,575 (GRCm39) unclassified probably benign
FR4976:Lce1m UTSW 3 92,925,455 (GRCm39) unclassified probably benign
R1513:Lce1m UTSW 3 92,925,932 (GRCm39) unclassified probably benign
R7621:Lce1m UTSW 3 92,925,177 (GRCm39) splice site probably null
RF001:Lce1m UTSW 3 92,925,576 (GRCm39) unclassified probably benign
RF001:Lce1m UTSW 3 92,925,459 (GRCm39) unclassified probably benign
RF002:Lce1m UTSW 3 92,925,606 (GRCm39) unclassified probably benign
RF002:Lce1m UTSW 3 92,925,590 (GRCm39) unclassified probably benign
RF007:Lce1m UTSW 3 92,925,451 (GRCm39) unclassified probably benign
RF009:Lce1m UTSW 3 92,925,438 (GRCm39) unclassified probably benign
RF010:Lce1m UTSW 3 92,925,597 (GRCm39) unclassified probably benign
RF015:Lce1m UTSW 3 92,925,455 (GRCm39) unclassified probably benign
RF021:Lce1m UTSW 3 92,925,602 (GRCm39) unclassified probably benign
RF021:Lce1m UTSW 3 92,925,576 (GRCm39) unclassified probably benign
RF023:Lce1m UTSW 3 92,925,587 (GRCm39) unclassified probably benign
RF026:Lce1m UTSW 3 92,925,450 (GRCm39) unclassified probably benign
RF026:Lce1m UTSW 3 92,925,445 (GRCm39) unclassified probably benign
RF028:Lce1m UTSW 3 92,925,438 (GRCm39) unclassified probably benign
RF030:Lce1m UTSW 3 92,925,651 (GRCm39) unclassified probably benign
RF030:Lce1m UTSW 3 92,925,448 (GRCm39) unclassified probably benign
RF037:Lce1m UTSW 3 92,925,607 (GRCm39) unclassified probably benign
RF041:Lce1m UTSW 3 92,925,448 (GRCm39) unclassified probably benign
RF042:Lce1m UTSW 3 92,925,446 (GRCm39) unclassified probably benign
RF045:Lce1m UTSW 3 92,925,599 (GRCm39) unclassified probably benign
RF046:Lce1m UTSW 3 92,925,600 (GRCm39) unclassified probably benign
RF054:Lce1m UTSW 3 92,925,605 (GRCm39) unclassified probably benign
RF059:Lce1m UTSW 3 92,925,636 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAGTCAATGCTGCTTTCCATG -3'
(R):5'- GTCTTCAAAGCAACATTTGAGCTG -3'

Sequencing Primer
(F):5'- CCATGTTCTTCGTGGCCAGG -3'
(R):5'- AGATGTCCTGTCAGCAGA -3'
Posted On 2019-11-26