Incidental Mutation 'R7753:Frem1'
ID597350
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R7753 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82913980 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1956 (D1956G)
Ref Sequence ENSEMBL: ENSMUSP00000071627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect probably benign
Transcript: ENSMUST00000071708
AA Change: D1956G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: D1956G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107230
AA Change: D1937G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: D1937G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170248
AA Change: D1938G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: D1938G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,184,107 T1377A probably damaging Het
AI661453 G T 17: 47,467,514 E722* probably null Het
Ap2b1 A T 11: 83,367,907 K735* probably null Het
Aqp4 T C 18: 15,399,976 E20G probably benign Het
Atp6v1b1 G T 6: 83,752,458 V117L probably benign Het
C1rb A G 6: 124,580,431 N509S probably benign Het
Cep44 A G 8: 56,532,807 V350A probably benign Het
Cmya5 T C 13: 93,098,172 Q136R probably benign Het
Cntrl T C 2: 35,111,679 S32P probably damaging Het
Cyp2d12 A T 15: 82,556,963 E201V possibly damaging Het
Cyp4a14 G T 4: 115,493,664 Q138K probably damaging Het
Dapk1 T C 13: 60,751,193 Y826H possibly damaging Het
Dbh A G 2: 27,171,436 D294G probably benign Het
Ddx10 A T 9: 53,225,604 L336Q probably damaging Het
Dopey1 A G 9: 86,489,702 T149A possibly damaging Het
Epg5 A G 18: 77,948,345 T86A possibly damaging Het
Fam171a1 A T 2: 3,178,317 Q60L probably damaging Het
Farsb T A 1: 78,480,103 E41D probably benign Het
Fzd4 T A 7: 89,407,784 Y346* probably null Het
Fzd7 A T 1: 59,483,482 S175C probably benign Het
Gdi2 A G 13: 3,548,956 T47A probably benign Het
Gm8765 A T 13: 50,701,781 D485V probably damaging Het
Gpr155 A T 2: 73,382,206 H24Q probably benign Het
Hdac7 A T 15: 97,800,761 N638K possibly damaging Het
Hdac7 G T 15: 97,806,488 N515K probably benign Het
Hnrnpul2 T C 19: 8,824,972 V401A probably damaging Het
Ifi27l2b T A 12: 103,451,260 R223* probably null Het
Igkv4-91 T G 6: 68,768,777 S46R probably benign Het
Itk T A 11: 46,331,895 L582F probably damaging Het
Kcnab2 T C 4: 152,396,761 I181V probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC GCCACAGCCTCC 7: 142,175,399 probably benign Het
Lce1m C A 3: 93,018,508 G41W unknown Het
Mapk10 T A 5: 103,038,553 K98* probably null Het
Mapk8ip2 A G 15: 89,461,653 E812G probably damaging Het
Mlh1 C A 9: 111,252,863 probably null Het
Mroh1 A G 15: 76,433,275 D784G possibly damaging Het
Neo1 A T 9: 58,956,005 D426E probably benign Het
Nol4 T A 18: 23,038,602 M1L probably benign Het
Nr1h3 A G 2: 91,185,025 F338S probably damaging Het
Oasl2 A G 5: 114,905,057 K297E probably benign Het
Olfr1030 A G 2: 85,984,716 N292S possibly damaging Het
Olfr1129 A G 2: 87,575,797 T238A probably benign Het
Olfr1306 A G 2: 111,912,582 I116T probably benign Het
Olfr419 C T 1: 174,250,670 V86I probably benign Het
Olfr683 T C 7: 105,143,800 I164M probably benign Het
Osbpl9 T C 4: 109,133,773 T97A possibly damaging Het
P3h2 A T 16: 25,970,937 Y527N probably damaging Het
Papss2 A T 19: 32,620,179 H9L probably benign Het
Pcdha4 C A 18: 36,953,301 S179Y possibly damaging Het
Ppt1 A T 4: 122,836,338 D28V possibly damaging Het
Prkcz T A 4: 155,272,968 Q345L possibly damaging Het
Prr14l G T 5: 32,827,253 L1633I probably damaging Het
Prss51 T A 14: 64,095,927 V13D possibly damaging Het
Qrich2 TTGCAACACACCAGGCTGAACTGGACCTTGCTG TTG 11: 116,457,042 probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slc2a7 T C 4: 150,154,684 I122T possibly damaging Het
Sprr3 G A 3: 92,457,108 P143L probably benign Het
Sugct A T 13: 17,577,519 S181T possibly damaging Het
Syne2 G A 12: 76,038,923 R141Q probably benign Het
Taok1 T C 11: 77,537,899 I992V probably benign Het
Tbc1d21 A C 9: 58,362,023 probably null Het
Thada T C 17: 84,252,390 D1453G probably damaging Het
Thoc5 T C 11: 4,902,156 L104S probably damaging Het
Tln2 T G 9: 67,395,473 Y72S probably damaging Het
Tmem98 A G 11: 80,814,311 E75G probably damaging Het
Tox3 A G 8: 90,248,932 L357P probably damaging Het
Ubr4 T C 4: 139,470,292 V4492A unknown Het
Ulk4 A G 9: 121,266,512 probably null Het
Ush2a A G 1: 188,443,406 T1234A probably benign Het
Usp53 G A 3: 122,949,238 T683I probably damaging Het
Vcan T A 13: 89,689,323 I2701F probably damaging Het
Vmn2r72 G A 7: 85,750,626 A405V probably damaging Het
Vmn2r96 A T 17: 18,586,401 T537S possibly damaging Het
Vstm2a G T 11: 16,263,040 A142S probably damaging Het
Zbtb41 A G 1: 139,447,157 D785G probably benign Het
Zfp397 A T 18: 23,957,072 Q144H probably benign Het
Zfp518a A T 19: 40,915,805 T1393S possibly damaging Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
R0519_frem1_373 UTSW 4 82970633 critical splice donor site probably null
R1115_Frem1_145 UTSW 4 83020770 missense probably benign 0.28
R4764_Frem1_085 UTSW 4 82989189 missense probably damaging 1.00
R6165_Frem1_083 UTSW 4 82956255 missense probably benign 0.16
R6324_Frem1_643 UTSW 4 82983337 missense probably benign 0.00
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 splice site probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7886:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7976:Frem1 UTSW 4 83001709 missense probably damaging 0.97
R8240:Frem1 UTSW 4 82956248 missense probably benign 0.21
R8305:Frem1 UTSW 4 82999989 missense probably benign 0.06
R8415:Frem1 UTSW 4 83000262 missense probably damaging 1.00
R8751:Frem1 UTSW 4 82970778 missense probably damaging 1.00
R8819:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8820:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8829:Frem1 UTSW 4 83000194 missense probably damaging 1.00
R8834:Frem1 UTSW 4 83004373 missense probably damaging 1.00
R8910:Frem1 UTSW 4 82950457 missense probably benign 0.09
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82999983 missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82940315 critical splice donor site probably null
Z1177:Frem1 UTSW 4 83000269 missense probably benign 0.39
Z1177:Frem1 UTSW 4 83016464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTTAAAAGACAGCATCAAGGC -3'
(R):5'- TCAGCATGATCATGAGCTGTG -3'

Sequencing Primer
(F):5'- GCAAAGAGACAAAAAGGATTTTTCTC -3'
(R):5'- TGCGCACATACGTCTTT -3'
Posted On2019-11-26