Incidental Mutation 'R7753:Prkcz'
ID597357
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Nameprotein kinase C, zeta
SynonymsPkcz, zetaPKC, aPKCzeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7753 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155260129-155361361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155272968 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 345 (Q345L)
Ref Sequence ENSEMBL: ENSMUSP00000030922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000103178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030922
AA Change: Q345L

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053
AA Change: Q345L

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103178
AA Change: Q162L

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099467
Gene: ENSMUSG00000029053
AA Change: Q162L

DomainStartEndE-ValueType
S_TKc 69 335 5.49e-94 SMART
S_TK_X 336 399 2.58e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,184,107 T1377A probably damaging Het
AI661453 G T 17: 47,467,514 E722* probably null Het
Ap2b1 A T 11: 83,367,907 K735* probably null Het
Aqp4 T C 18: 15,399,976 E20G probably benign Het
Atp6v1b1 G T 6: 83,752,458 V117L probably benign Het
C1rb A G 6: 124,580,431 N509S probably benign Het
Cep44 A G 8: 56,532,807 V350A probably benign Het
Cmya5 T C 13: 93,098,172 Q136R probably benign Het
Cntrl T C 2: 35,111,679 S32P probably damaging Het
Cyp2d12 A T 15: 82,556,963 E201V possibly damaging Het
Cyp4a14 G T 4: 115,493,664 Q138K probably damaging Het
Dapk1 T C 13: 60,751,193 Y826H possibly damaging Het
Dbh A G 2: 27,171,436 D294G probably benign Het
Ddx10 A T 9: 53,225,604 L336Q probably damaging Het
Dopey1 A G 9: 86,489,702 T149A possibly damaging Het
Epg5 A G 18: 77,948,345 T86A possibly damaging Het
Fam171a1 A T 2: 3,178,317 Q60L probably damaging Het
Farsb T A 1: 78,480,103 E41D probably benign Het
Frem1 T C 4: 82,913,980 D1956G probably benign Het
Fzd4 T A 7: 89,407,784 Y346* probably null Het
Fzd7 A T 1: 59,483,482 S175C probably benign Het
Gdi2 A G 13: 3,548,956 T47A probably benign Het
Gm8765 A T 13: 50,701,781 D485V probably damaging Het
Gpr155 A T 2: 73,382,206 H24Q probably benign Het
Hdac7 A T 15: 97,800,761 N638K possibly damaging Het
Hdac7 G T 15: 97,806,488 N515K probably benign Het
Hnrnpul2 T C 19: 8,824,972 V401A probably damaging Het
Ifi27l2b T A 12: 103,451,260 R223* probably null Het
Igkv4-91 T G 6: 68,768,777 S46R probably benign Het
Itk T A 11: 46,331,895 L582F probably damaging Het
Kcnab2 T C 4: 152,396,761 I181V probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC GCCACAGCCTCC 7: 142,175,399 probably benign Het
Lce1m C A 3: 93,018,508 G41W unknown Het
Mapk10 T A 5: 103,038,553 K98* probably null Het
Mapk8ip2 A G 15: 89,461,653 E812G probably damaging Het
Mlh1 C A 9: 111,252,863 probably null Het
Mroh1 A G 15: 76,433,275 D784G possibly damaging Het
Neo1 A T 9: 58,956,005 D426E probably benign Het
Nol4 T A 18: 23,038,602 M1L probably benign Het
Nr1h3 A G 2: 91,185,025 F338S probably damaging Het
Oasl2 A G 5: 114,905,057 K297E probably benign Het
Olfr1030 A G 2: 85,984,716 N292S possibly damaging Het
Olfr1129 A G 2: 87,575,797 T238A probably benign Het
Olfr1306 A G 2: 111,912,582 I116T probably benign Het
Olfr419 C T 1: 174,250,670 V86I probably benign Het
Olfr683 T C 7: 105,143,800 I164M probably benign Het
Osbpl9 T C 4: 109,133,773 T97A possibly damaging Het
P3h2 A T 16: 25,970,937 Y527N probably damaging Het
Papss2 A T 19: 32,620,179 H9L probably benign Het
Pcdha4 C A 18: 36,953,301 S179Y possibly damaging Het
Ppt1 A T 4: 122,836,338 D28V possibly damaging Het
Prr14l G T 5: 32,827,253 L1633I probably damaging Het
Prss51 T A 14: 64,095,927 V13D possibly damaging Het
Qrich2 TTGCAACACACCAGGCTGAACTGGACCTTGCTG TTG 11: 116,457,042 probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slc2a7 T C 4: 150,154,684 I122T possibly damaging Het
Sprr3 G A 3: 92,457,108 P143L probably benign Het
Sugct A T 13: 17,577,519 S181T possibly damaging Het
Syne2 G A 12: 76,038,923 R141Q probably benign Het
Taok1 T C 11: 77,537,899 I992V probably benign Het
Tbc1d21 A C 9: 58,362,023 probably null Het
Thada T C 17: 84,252,390 D1453G probably damaging Het
Thoc5 T C 11: 4,902,156 L104S probably damaging Het
Tln2 T G 9: 67,395,473 Y72S probably damaging Het
Tmem98 A G 11: 80,814,311 E75G probably damaging Het
Tox3 A G 8: 90,248,932 L357P probably damaging Het
Ubr4 T C 4: 139,470,292 V4492A unknown Het
Ulk4 A G 9: 121,266,512 probably null Het
Ush2a A G 1: 188,443,406 T1234A probably benign Het
Usp53 G A 3: 122,949,238 T683I probably damaging Het
Vcan T A 13: 89,689,323 I2701F probably damaging Het
Vmn2r72 G A 7: 85,750,626 A405V probably damaging Het
Vmn2r96 A T 17: 18,586,401 T537S possibly damaging Het
Vstm2a G T 11: 16,263,040 A142S probably damaging Het
Zbtb41 A G 1: 139,447,157 D785G probably benign Het
Zfp397 A T 18: 23,957,072 Q144H probably benign Het
Zfp518a A T 19: 40,915,805 T1393S possibly damaging Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155294401 splice site probably benign
IGL02114:Prkcz APN 4 155271590 missense probably damaging 1.00
IGL02582:Prkcz APN 4 155271256 missense probably damaging 1.00
IGL03010:Prkcz APN 4 155286805 missense probably damaging 1.00
IGL03199:Prkcz APN 4 155272984 missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155268195 missense probably damaging 0.99
IGL03229:Prkcz APN 4 155262506 missense probably benign 0.19
IGL03299:Prkcz APN 4 155286790 missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155293156 critical splice donor site probably null
R0389:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R0443:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R1666:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1668:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1686:Prkcz UTSW 4 155271256 missense probably damaging 1.00
R1710:Prkcz UTSW 4 155262512 missense probably damaging 1.00
R2025:Prkcz UTSW 4 155289710 missense probably damaging 1.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R4399:Prkcz UTSW 4 155269077 missense possibly damaging 0.86
R4780:Prkcz UTSW 4 155289702 missense probably damaging 1.00
R4923:Prkcz UTSW 4 155357489 missense probably damaging 1.00
R5160:Prkcz UTSW 4 155293232 missense probably benign 0.22
R5510:Prkcz UTSW 4 155272936 splice site probably null
R6278:Prkcz UTSW 4 155268195 missense probably damaging 0.99
R6290:Prkcz UTSW 4 155356499 missense probably damaging 1.00
R6881:Prkcz UTSW 4 155269056 missense possibly damaging 0.90
R7055:Prkcz UTSW 4 155289634 missense probably benign 0.01
R7108:Prkcz UTSW 4 155286793 nonsense probably null
R7241:Prkcz UTSW 4 155269059 missense probably benign 0.00
R7355:Prkcz UTSW 4 155357496 missense probably damaging 1.00
R7466:Prkcz UTSW 4 155271602 missense probably damaging 1.00
R7522:Prkcz UTSW 4 155271285 missense probably damaging 1.00
R7618:Prkcz UTSW 4 155262482 missense probably damaging 1.00
R8079:Prkcz UTSW 4 155357505 missense probably damaging 1.00
R8407:Prkcz UTSW 4 155268216 missense probably damaging 0.99
R8523:Prkcz UTSW 4 155262511 missense probably damaging 1.00
R8824:Prkcz UTSW 4 155344828 start gained probably benign
X0067:Prkcz UTSW 4 155354704 missense probably benign 0.25
Z1176:Prkcz UTSW 4 155354680 missense probably damaging 1.00
Z1176:Prkcz UTSW 4 155356468 missense probably damaging 1.00
Z1177:Prkcz UTSW 4 155301004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGTCTGGAGAGGGACC -3'
(R):5'- ATCTCTGTAAGAGGCAGCCG -3'

Sequencing Primer
(F):5'- CAGTCCTGGGCACAAAGC -3'
(R):5'- CTGTAAGAGGCAGCCGGTCAG -3'
Posted On2019-11-26