Incidental Mutation 'R7753:Prr14l'
ID 597358
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R7753 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 32789820-32854256 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 32827253 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 1633 (L1633I)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably damaging
Transcript: ENSMUST00000120129
AA Change: L1633I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: L1633I

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155392
AA Change: L476I

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280
AA Change: L476I

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,184,107 T1377A probably damaging Het
AI661453 G T 17: 47,467,514 E722* probably null Het
Ap2b1 A T 11: 83,367,907 K735* probably null Het
Aqp4 T C 18: 15,399,976 E20G probably benign Het
Atp6v1b1 G T 6: 83,752,458 V117L probably benign Het
C1rb A G 6: 124,580,431 N509S probably benign Het
Cep44 A G 8: 56,532,807 V350A probably benign Het
Cmya5 T C 13: 93,098,172 Q136R probably benign Het
Cntrl T C 2: 35,111,679 S32P probably damaging Het
Cyp2d12 A T 15: 82,556,963 E201V possibly damaging Het
Cyp4a14 G T 4: 115,493,664 Q138K probably damaging Het
Dapk1 T C 13: 60,751,193 Y826H possibly damaging Het
Dbh A G 2: 27,171,436 D294G probably benign Het
Ddx10 A T 9: 53,225,604 L336Q probably damaging Het
Dopey1 A G 9: 86,489,702 T149A possibly damaging Het
Epg5 A G 18: 77,948,345 T86A possibly damaging Het
Fam171a1 A T 2: 3,178,317 Q60L probably damaging Het
Farsb T A 1: 78,480,103 E41D probably benign Het
Frem1 T C 4: 82,913,980 D1956G probably benign Het
Fzd4 T A 7: 89,407,784 Y346* probably null Het
Fzd7 A T 1: 59,483,482 S175C probably benign Het
Gdi2 A G 13: 3,548,956 T47A probably benign Het
Gm8765 A T 13: 50,701,781 D485V probably damaging Het
Gpr155 A T 2: 73,382,206 H24Q probably benign Het
Hdac7 A T 15: 97,800,761 N638K possibly damaging Het
Hdac7 G T 15: 97,806,488 N515K probably benign Het
Hnrnpul2 T C 19: 8,824,972 V401A probably damaging Het
Ifi27l2b T A 12: 103,451,260 R223* probably null Het
Igkv4-91 T G 6: 68,768,777 S46R probably benign Het
Itk T A 11: 46,331,895 L582F probably damaging Het
Kcnab2 T C 4: 152,396,761 I181V probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC GCCACAGCCTCC 7: 142,175,399 probably benign Het
Lce1m C A 3: 93,018,508 G41W unknown Het
Mapk10 T A 5: 103,038,553 K98* probably null Het
Mapk8ip2 A G 15: 89,461,653 E812G probably damaging Het
Mlh1 C A 9: 111,252,863 probably null Het
Mroh1 A G 15: 76,433,275 D784G possibly damaging Het
Neo1 A T 9: 58,956,005 D426E probably benign Het
Nol4 T A 18: 23,038,602 M1L probably benign Het
Nr1h3 A G 2: 91,185,025 F338S probably damaging Het
Oasl2 A G 5: 114,905,057 K297E probably benign Het
Olfr1030 A G 2: 85,984,716 N292S possibly damaging Het
Olfr1129 A G 2: 87,575,797 T238A probably benign Het
Olfr1306 A G 2: 111,912,582 I116T probably benign Het
Olfr419 C T 1: 174,250,670 V86I probably benign Het
Olfr683 T C 7: 105,143,800 I164M probably benign Het
Osbpl9 T C 4: 109,133,773 T97A possibly damaging Het
P3h2 A T 16: 25,970,937 Y527N probably damaging Het
Papss2 A T 19: 32,620,179 H9L probably benign Het
Pcdha4 C A 18: 36,953,301 S179Y possibly damaging Het
Ppt1 A T 4: 122,836,338 D28V possibly damaging Het
Prkcz T A 4: 155,272,968 Q345L possibly damaging Het
Prss51 T A 14: 64,095,927 V13D possibly damaging Het
Qrich2 TTGCAACACACCAGGCTGAACTGGACCTTGCTG TTG 11: 116,457,042 probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slc2a7 T C 4: 150,154,684 I122T possibly damaging Het
Sprr3 G A 3: 92,457,108 P143L probably benign Het
Sugct A T 13: 17,577,519 S181T possibly damaging Het
Syne2 G A 12: 76,038,923 R141Q probably benign Het
Taok1 T C 11: 77,537,899 I992V probably benign Het
Tbc1d21 A C 9: 58,362,023 probably null Het
Thada T C 17: 84,252,390 D1453G probably damaging Het
Thoc5 T C 11: 4,902,156 L104S probably damaging Het
Tln2 T G 9: 67,395,473 Y72S probably damaging Het
Tmem98 A G 11: 80,814,311 E75G probably damaging Het
Tox3 A G 8: 90,248,932 L357P probably damaging Het
Ubr4 T C 4: 139,470,292 V4492A unknown Het
Ulk4 A G 9: 121,266,512 probably null Het
Ush2a A G 1: 188,443,406 T1234A probably benign Het
Usp53 G A 3: 122,949,238 T683I probably damaging Het
Vcan T A 13: 89,689,323 I2701F probably damaging Het
Vmn2r72 G A 7: 85,750,626 A405V probably damaging Het
Vmn2r96 A T 17: 18,586,401 T537S possibly damaging Het
Vstm2a G T 11: 16,263,040 A142S probably damaging Het
Zbtb41 A G 1: 139,447,157 D785G probably benign Het
Zfp397 A T 18: 23,957,072 Q144H probably benign Het
Zfp518a A T 19: 40,915,805 T1393S possibly damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
R9052:Prr14l UTSW 5 32830134 nonsense probably null
R9136:Prr14l UTSW 5 32828736 missense
Predicted Primers PCR Primer
(F):5'- GGCAGAGAACAGAAGACCTTATCTG -3'
(R):5'- ACTTTTCCTGAGCACTGCGC -3'

Sequencing Primer
(F):5'- GAAGACCTTATCTGCTATAGAGGCTG -3'
(R):5'- ATCGAGGCTTGCCTTAACAG -3'
Posted On 2019-11-26