Incidental Mutation 'R7753:Ulk4'
ID 597376
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 045809-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R7753 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 121095578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923] [ENSMUST00000171923] [ENSMUST00000171923] [ENSMUST00000171923] [ENSMUST00000171923] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,074,933 (GRCm39) T1377A probably damaging Het
AI661453 G T 17: 47,778,439 (GRCm39) E722* probably null Het
Ap2b1 A T 11: 83,258,733 (GRCm39) K735* probably null Het
Aqp4 T C 18: 15,533,033 (GRCm39) E20G probably benign Het
Atp6v1b1 G T 6: 83,729,440 (GRCm39) V117L probably benign Het
C1rb A G 6: 124,557,390 (GRCm39) N509S probably benign Het
Cep44 A G 8: 56,985,842 (GRCm39) V350A probably benign Het
Cmya5 T C 13: 93,234,680 (GRCm39) Q136R probably benign Het
Cntrl T C 2: 35,001,691 (GRCm39) S32P probably damaging Het
Cyp2d12 A T 15: 82,441,164 (GRCm39) E201V possibly damaging Het
Cyp4a14 G T 4: 115,350,861 (GRCm39) Q138K probably damaging Het
Dapk1 T C 13: 60,899,007 (GRCm39) Y826H possibly damaging Het
Dbh A G 2: 27,061,448 (GRCm39) D294G probably benign Het
Ddx10 A T 9: 53,136,904 (GRCm39) L336Q probably damaging Het
Dop1a A G 9: 86,371,755 (GRCm39) T149A possibly damaging Het
Epg5 A G 18: 77,991,560 (GRCm39) T86A possibly damaging Het
Fam171a1 A T 2: 3,179,354 (GRCm39) Q60L probably damaging Het
Farsb T A 1: 78,456,740 (GRCm39) E41D probably benign Het
Frem1 T C 4: 82,832,217 (GRCm39) D1956G probably benign Het
Fzd4 T A 7: 89,056,992 (GRCm39) Y346* probably null Het
Fzd7 A T 1: 59,522,641 (GRCm39) S175C probably benign Het
Gdi2 A G 13: 3,598,956 (GRCm39) T47A probably benign Het
Gpr155 A T 2: 73,212,550 (GRCm39) H24Q probably benign Het
Hdac7 A T 15: 97,698,642 (GRCm39) N638K possibly damaging Het
Hdac7 G T 15: 97,704,369 (GRCm39) N515K probably benign Het
Hnrnpul2 T C 19: 8,802,336 (GRCm39) V401A probably damaging Het
Ifi27l2b T A 12: 103,417,519 (GRCm39) R223* probably null Het
Igkv4-91 T G 6: 68,745,761 (GRCm39) S46R probably benign Het
Itk T A 11: 46,222,722 (GRCm39) L582F probably damaging Het
Kcnab2 T C 4: 152,481,218 (GRCm39) I181V probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC GCCACAGCCTCC 7: 141,729,136 (GRCm39) probably benign Het
Lce1m C A 3: 92,925,815 (GRCm39) G41W unknown Het
Mapk10 T A 5: 103,186,419 (GRCm39) K98* probably null Het
Mapk8ip2 A G 15: 89,345,856 (GRCm39) E812G probably damaging Het
Mlh1 C A 9: 111,081,931 (GRCm39) probably null Het
Mroh1 A G 15: 76,317,475 (GRCm39) D784G possibly damaging Het
Neo1 A T 9: 58,863,288 (GRCm39) D426E probably benign Het
Nol4 T A 18: 23,171,659 (GRCm39) M1L probably benign Het
Nr1h3 A G 2: 91,015,370 (GRCm39) F338S probably damaging Het
Oasl2 A G 5: 115,043,118 (GRCm39) K297E probably benign Het
Or10ag59 A G 2: 87,406,141 (GRCm39) T238A probably benign Het
Or10z1 C T 1: 174,078,236 (GRCm39) V86I probably benign Het
Or4f14 A G 2: 111,742,927 (GRCm39) I116T probably benign Het
Or56a5 T C 7: 104,793,007 (GRCm39) I164M probably benign Het
Or5m5 A G 2: 85,815,060 (GRCm39) N292S possibly damaging Het
Osbpl9 T C 4: 108,990,970 (GRCm39) T97A possibly damaging Het
P3h2 A T 16: 25,789,687 (GRCm39) Y527N probably damaging Het
Papss2 A T 19: 32,597,579 (GRCm39) H9L probably benign Het
Pcdha4 C A 18: 37,086,354 (GRCm39) S179Y possibly damaging Het
Ppt1 A T 4: 122,730,131 (GRCm39) D28V possibly damaging Het
Prkcz T A 4: 155,357,425 (GRCm39) Q345L possibly damaging Het
Prr14l G T 5: 32,984,597 (GRCm39) L1633I probably damaging Het
Prss51 T A 14: 64,333,376 (GRCm39) V13D possibly damaging Het
Qrich2 TTGCAACACACCAGGCTGAACTGGACCTTGCTG TTG 11: 116,347,868 (GRCm39) probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Slc2a7 T C 4: 150,239,141 (GRCm39) I122T possibly damaging Het
Spata31e4 A T 13: 50,855,817 (GRCm39) D485V probably damaging Het
Sprr3 G A 3: 92,364,415 (GRCm39) P143L probably benign Het
Sugct A T 13: 17,752,104 (GRCm39) S181T possibly damaging Het
Syne2 G A 12: 76,085,697 (GRCm39) R141Q probably benign Het
Taok1 T C 11: 77,428,725 (GRCm39) I992V probably benign Het
Tbc1d21 A C 9: 58,269,306 (GRCm39) probably null Het
Thada T C 17: 84,559,818 (GRCm39) D1453G probably damaging Het
Thoc5 T C 11: 4,852,156 (GRCm39) L104S probably damaging Het
Tln2 T G 9: 67,302,755 (GRCm39) Y72S probably damaging Het
Tmem98 A G 11: 80,705,137 (GRCm39) E75G probably damaging Het
Tox3 A G 8: 90,975,560 (GRCm39) L357P probably damaging Het
Ubr4 T C 4: 139,197,603 (GRCm39) V4492A unknown Het
Ush2a A G 1: 188,175,603 (GRCm39) T1234A probably benign Het
Usp53 G A 3: 122,742,887 (GRCm39) T683I probably damaging Het
Vcan T A 13: 89,837,442 (GRCm39) I2701F probably damaging Het
Vmn2r72 G A 7: 85,399,834 (GRCm39) A405V probably damaging Het
Vmn2r96 A T 17: 18,806,663 (GRCm39) T537S possibly damaging Het
Vstm2a G T 11: 16,213,040 (GRCm39) A142S probably damaging Het
Zbtb41 A G 1: 139,374,895 (GRCm39) D785G probably benign Het
Zfp397 A T 18: 24,090,129 (GRCm39) Q144H probably benign Het
Zfp518a A T 19: 40,904,249 (GRCm39) T1393S possibly damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4572:Ulk4 UTSW 9 121,021,830 (GRCm39) missense probably damaging 1.00
R4647:Ulk4 UTSW 9 120,970,918 (GRCm39) missense probably benign 0.15
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4737:Ulk4 UTSW 9 120,902,938 (GRCm39) nonsense probably null
R4781:Ulk4 UTSW 9 120,932,642 (GRCm39) missense probably benign 0.00
R4860:Ulk4 UTSW 9 121,079,968 (GRCm39) missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7790:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121,095,317 (GRCm39) missense probably damaging 0.99
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8246:Ulk4 UTSW 9 120,985,941 (GRCm39) makesense probably null
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9092:Ulk4 UTSW 9 120,903,003 (GRCm39) missense
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCACGACATCTTCTGGGAG -3'
(R):5'- GCTTACTTCTGATGGCCGTAAAC -3'

Sequencing Primer
(F):5'- CCTGAGCAATCACGGTTTCTAGAG -3'
(R):5'- CGTAAACAAACCCTACAGTTAGTGTG -3'
Posted On 2019-11-26