Incidental Mutation 'R7753:Ulk4'
ID597376
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R7753 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 121266512 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923] [ENSMUST00000171923] [ENSMUST00000171923] [ENSMUST00000171923] [ENSMUST00000171923] [ENSMUST00000171923]
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051479
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,184,107 T1377A probably damaging Het
AI661453 G T 17: 47,467,514 E722* probably null Het
Ap2b1 A T 11: 83,367,907 K735* probably null Het
Aqp4 T C 18: 15,399,976 E20G probably benign Het
Atp6v1b1 G T 6: 83,752,458 V117L probably benign Het
C1rb A G 6: 124,580,431 N509S probably benign Het
Cep44 A G 8: 56,532,807 V350A probably benign Het
Cmya5 T C 13: 93,098,172 Q136R probably benign Het
Cntrl T C 2: 35,111,679 S32P probably damaging Het
Cyp2d12 A T 15: 82,556,963 E201V possibly damaging Het
Cyp4a14 G T 4: 115,493,664 Q138K probably damaging Het
Dapk1 T C 13: 60,751,193 Y826H possibly damaging Het
Dbh A G 2: 27,171,436 D294G probably benign Het
Ddx10 A T 9: 53,225,604 L336Q probably damaging Het
Dopey1 A G 9: 86,489,702 T149A possibly damaging Het
Epg5 A G 18: 77,948,345 T86A possibly damaging Het
Fam171a1 A T 2: 3,178,317 Q60L probably damaging Het
Farsb T A 1: 78,480,103 E41D probably benign Het
Frem1 T C 4: 82,913,980 D1956G probably benign Het
Fzd4 T A 7: 89,407,784 Y346* probably null Het
Fzd7 A T 1: 59,483,482 S175C probably benign Het
Gdi2 A G 13: 3,548,956 T47A probably benign Het
Gm8765 A T 13: 50,701,781 D485V probably damaging Het
Gpr155 A T 2: 73,382,206 H24Q probably benign Het
Hdac7 A T 15: 97,800,761 N638K possibly damaging Het
Hdac7 G T 15: 97,806,488 N515K probably benign Het
Hnrnpul2 T C 19: 8,824,972 V401A probably damaging Het
Ifi27l2b T A 12: 103,451,260 R223* probably null Het
Igkv4-91 T G 6: 68,768,777 S46R probably benign Het
Itk T A 11: 46,331,895 L582F probably damaging Het
Kcnab2 T C 4: 152,396,761 I181V probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC GCCACAGCCTCC 7: 142,175,399 probably benign Het
Lce1m C A 3: 93,018,508 G41W unknown Het
Mapk10 T A 5: 103,038,553 K98* probably null Het
Mapk8ip2 A G 15: 89,461,653 E812G probably damaging Het
Mlh1 C A 9: 111,252,863 probably null Het
Mroh1 A G 15: 76,433,275 D784G possibly damaging Het
Neo1 A T 9: 58,956,005 D426E probably benign Het
Nol4 T A 18: 23,038,602 M1L probably benign Het
Nr1h3 A G 2: 91,185,025 F338S probably damaging Het
Oasl2 A G 5: 114,905,057 K297E probably benign Het
Olfr1030 A G 2: 85,984,716 N292S possibly damaging Het
Olfr1129 A G 2: 87,575,797 T238A probably benign Het
Olfr1306 A G 2: 111,912,582 I116T probably benign Het
Olfr419 C T 1: 174,250,670 V86I probably benign Het
Olfr683 T C 7: 105,143,800 I164M probably benign Het
Osbpl9 T C 4: 109,133,773 T97A possibly damaging Het
P3h2 A T 16: 25,970,937 Y527N probably damaging Het
Papss2 A T 19: 32,620,179 H9L probably benign Het
Pcdha4 C A 18: 36,953,301 S179Y possibly damaging Het
Ppt1 A T 4: 122,836,338 D28V possibly damaging Het
Prkcz T A 4: 155,272,968 Q345L possibly damaging Het
Prr14l G T 5: 32,827,253 L1633I probably damaging Het
Prss51 T A 14: 64,095,927 V13D possibly damaging Het
Qrich2 TTGCAACACACCAGGCTGAACTGGACCTTGCTG TTG 11: 116,457,042 probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slc2a7 T C 4: 150,154,684 I122T possibly damaging Het
Sprr3 G A 3: 92,457,108 P143L probably benign Het
Sugct A T 13: 17,577,519 S181T possibly damaging Het
Syne2 G A 12: 76,038,923 R141Q probably benign Het
Taok1 T C 11: 77,537,899 I992V probably benign Het
Tbc1d21 A C 9: 58,362,023 probably null Het
Thada T C 17: 84,252,390 D1453G probably damaging Het
Thoc5 T C 11: 4,902,156 L104S probably damaging Het
Tln2 T G 9: 67,395,473 Y72S probably damaging Het
Tmem98 A G 11: 80,814,311 E75G probably damaging Het
Tox3 A G 8: 90,248,932 L357P probably damaging Het
Ubr4 T C 4: 139,470,292 V4492A unknown Het
Ush2a A G 1: 188,443,406 T1234A probably benign Het
Usp53 G A 3: 122,949,238 T683I probably damaging Het
Vcan T A 13: 89,689,323 I2701F probably damaging Het
Vmn2r72 G A 7: 85,750,626 A405V probably damaging Het
Vmn2r96 A T 17: 18,586,401 T537S possibly damaging Het
Vstm2a G T 11: 16,263,040 A142S probably damaging Het
Zbtb41 A G 1: 139,447,157 D785G probably benign Het
Zfp397 A T 18: 23,957,072 Q144H probably benign Het
Zfp518a A T 19: 40,915,805 T1393S possibly damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCACGACATCTTCTGGGAG -3'
(R):5'- GCTTACTTCTGATGGCCGTAAAC -3'

Sequencing Primer
(F):5'- CCTGAGCAATCACGGTTTCTAGAG -3'
(R):5'- CGTAAACAAACCCTACAGTTAGTGTG -3'
Posted On2019-11-26