Incidental Mutation 'R7753:Ap2b1'
ID 597382
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Name adaptor-related protein complex 2, beta 1 subunit
Synonyms 1300012O03Rik
MMRRC Submission 045809-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7753 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 83189850-83295861 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 83258733 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 735 (K735*)
Ref Sequence ENSEMBL: ENSMUSP00000018875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]
AlphaFold Q9DBG3
Predicted Effect probably null
Transcript: ENSMUST00000018875
AA Change: K735*
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: K735*

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065692
AA Change: K721*
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: K721*

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176430
AA Change: K735*
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: K735*

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176523
AA Change: K697*
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: K697*

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,074,933 (GRCm39) T1377A probably damaging Het
AI661453 G T 17: 47,778,439 (GRCm39) E722* probably null Het
Aqp4 T C 18: 15,533,033 (GRCm39) E20G probably benign Het
Atp6v1b1 G T 6: 83,729,440 (GRCm39) V117L probably benign Het
C1rb A G 6: 124,557,390 (GRCm39) N509S probably benign Het
Cep44 A G 8: 56,985,842 (GRCm39) V350A probably benign Het
Cmya5 T C 13: 93,234,680 (GRCm39) Q136R probably benign Het
Cntrl T C 2: 35,001,691 (GRCm39) S32P probably damaging Het
Cyp2d12 A T 15: 82,441,164 (GRCm39) E201V possibly damaging Het
Cyp4a14 G T 4: 115,350,861 (GRCm39) Q138K probably damaging Het
Dapk1 T C 13: 60,899,007 (GRCm39) Y826H possibly damaging Het
Dbh A G 2: 27,061,448 (GRCm39) D294G probably benign Het
Ddx10 A T 9: 53,136,904 (GRCm39) L336Q probably damaging Het
Dop1a A G 9: 86,371,755 (GRCm39) T149A possibly damaging Het
Epg5 A G 18: 77,991,560 (GRCm39) T86A possibly damaging Het
Fam171a1 A T 2: 3,179,354 (GRCm39) Q60L probably damaging Het
Farsb T A 1: 78,456,740 (GRCm39) E41D probably benign Het
Frem1 T C 4: 82,832,217 (GRCm39) D1956G probably benign Het
Fzd4 T A 7: 89,056,992 (GRCm39) Y346* probably null Het
Fzd7 A T 1: 59,522,641 (GRCm39) S175C probably benign Het
Gdi2 A G 13: 3,598,956 (GRCm39) T47A probably benign Het
Gpr155 A T 2: 73,212,550 (GRCm39) H24Q probably benign Het
Hdac7 A T 15: 97,698,642 (GRCm39) N638K possibly damaging Het
Hdac7 G T 15: 97,704,369 (GRCm39) N515K probably benign Het
Hnrnpul2 T C 19: 8,802,336 (GRCm39) V401A probably damaging Het
Ifi27l2b T A 12: 103,417,519 (GRCm39) R223* probably null Het
Igkv4-91 T G 6: 68,745,761 (GRCm39) S46R probably benign Het
Itk T A 11: 46,222,722 (GRCm39) L582F probably damaging Het
Kcnab2 T C 4: 152,481,218 (GRCm39) I181V probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC GCCACAGCCTCC 7: 141,729,136 (GRCm39) probably benign Het
Lce1m C A 3: 92,925,815 (GRCm39) G41W unknown Het
Mapk10 T A 5: 103,186,419 (GRCm39) K98* probably null Het
Mapk8ip2 A G 15: 89,345,856 (GRCm39) E812G probably damaging Het
Mlh1 C A 9: 111,081,931 (GRCm39) probably null Het
Mroh1 A G 15: 76,317,475 (GRCm39) D784G possibly damaging Het
Neo1 A T 9: 58,863,288 (GRCm39) D426E probably benign Het
Nol4 T A 18: 23,171,659 (GRCm39) M1L probably benign Het
Nr1h3 A G 2: 91,015,370 (GRCm39) F338S probably damaging Het
Oasl2 A G 5: 115,043,118 (GRCm39) K297E probably benign Het
Or10ag59 A G 2: 87,406,141 (GRCm39) T238A probably benign Het
Or10z1 C T 1: 174,078,236 (GRCm39) V86I probably benign Het
Or4f14 A G 2: 111,742,927 (GRCm39) I116T probably benign Het
Or56a5 T C 7: 104,793,007 (GRCm39) I164M probably benign Het
Or5m5 A G 2: 85,815,060 (GRCm39) N292S possibly damaging Het
Osbpl9 T C 4: 108,990,970 (GRCm39) T97A possibly damaging Het
P3h2 A T 16: 25,789,687 (GRCm39) Y527N probably damaging Het
Papss2 A T 19: 32,597,579 (GRCm39) H9L probably benign Het
Pcdha4 C A 18: 37,086,354 (GRCm39) S179Y possibly damaging Het
Ppt1 A T 4: 122,730,131 (GRCm39) D28V possibly damaging Het
Prkcz T A 4: 155,357,425 (GRCm39) Q345L possibly damaging Het
Prr14l G T 5: 32,984,597 (GRCm39) L1633I probably damaging Het
Prss51 T A 14: 64,333,376 (GRCm39) V13D possibly damaging Het
Qrich2 TTGCAACACACCAGGCTGAACTGGACCTTGCTG TTG 11: 116,347,868 (GRCm39) probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Slc2a7 T C 4: 150,239,141 (GRCm39) I122T possibly damaging Het
Spata31e4 A T 13: 50,855,817 (GRCm39) D485V probably damaging Het
Sprr3 G A 3: 92,364,415 (GRCm39) P143L probably benign Het
Sugct A T 13: 17,752,104 (GRCm39) S181T possibly damaging Het
Syne2 G A 12: 76,085,697 (GRCm39) R141Q probably benign Het
Taok1 T C 11: 77,428,725 (GRCm39) I992V probably benign Het
Tbc1d21 A C 9: 58,269,306 (GRCm39) probably null Het
Thada T C 17: 84,559,818 (GRCm39) D1453G probably damaging Het
Thoc5 T C 11: 4,852,156 (GRCm39) L104S probably damaging Het
Tln2 T G 9: 67,302,755 (GRCm39) Y72S probably damaging Het
Tmem98 A G 11: 80,705,137 (GRCm39) E75G probably damaging Het
Tox3 A G 8: 90,975,560 (GRCm39) L357P probably damaging Het
Ubr4 T C 4: 139,197,603 (GRCm39) V4492A unknown Het
Ulk4 A G 9: 121,095,578 (GRCm39) probably null Het
Ush2a A G 1: 188,175,603 (GRCm39) T1234A probably benign Het
Usp53 G A 3: 122,742,887 (GRCm39) T683I probably damaging Het
Vcan T A 13: 89,837,442 (GRCm39) I2701F probably damaging Het
Vmn2r72 G A 7: 85,399,834 (GRCm39) A405V probably damaging Het
Vmn2r96 A T 17: 18,806,663 (GRCm39) T537S possibly damaging Het
Vstm2a G T 11: 16,213,040 (GRCm39) A142S probably damaging Het
Zbtb41 A G 1: 139,374,895 (GRCm39) D785G probably benign Het
Zfp397 A T 18: 24,090,129 (GRCm39) Q144H probably benign Het
Zfp518a A T 19: 40,904,249 (GRCm39) T1393S possibly damaging Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83,223,984 (GRCm39) missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83,215,437 (GRCm39) missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83,212,799 (GRCm39) missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83,226,356 (GRCm39) missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83,237,592 (GRCm39) missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83,227,625 (GRCm39) missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83,232,210 (GRCm39) missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83,258,852 (GRCm39) missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83,212,793 (GRCm39) missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83,258,700 (GRCm39) splice site probably benign
R1222:Ap2b1 UTSW 11 83,237,564 (GRCm39) missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83,223,935 (GRCm39) missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83,237,657 (GRCm39) missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83,215,430 (GRCm39) missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83,227,212 (GRCm39) missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83,241,944 (GRCm39) missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83,215,587 (GRCm39) splice site probably benign
R3615:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83,281,542 (GRCm39) missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83,233,429 (GRCm39) missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83,226,430 (GRCm39) critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83,215,476 (GRCm39) missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83,288,605 (GRCm39) missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83,223,837 (GRCm39) nonsense probably null
R4916:Ap2b1 UTSW 11 83,281,532 (GRCm39) missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83,230,218 (GRCm39) missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83,233,427 (GRCm39) missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83,227,563 (GRCm39) splice site probably null
R5738:Ap2b1 UTSW 11 83,227,256 (GRCm39) splice site probably null
R6023:Ap2b1 UTSW 11 83,226,224 (GRCm39) missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83,237,499 (GRCm39) missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83,237,651 (GRCm39) missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83,199,065 (GRCm39) start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83,233,505 (GRCm39) missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83,226,317 (GRCm39) missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83,280,552 (GRCm39) missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83,223,948 (GRCm39) missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83,241,931 (GRCm39) missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83,258,824 (GRCm39) missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83,215,348 (GRCm39) missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83,280,554 (GRCm39) missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83,230,256 (GRCm39) critical splice donor site probably null
R8468:Ap2b1 UTSW 11 83,241,891 (GRCm39) missense probably damaging 1.00
R8943:Ap2b1 UTSW 11 83,237,579 (GRCm39) missense probably damaging 1.00
R9093:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
R9621:Ap2b1 UTSW 11 83,293,424 (GRCm39) missense probably damaging 1.00
X0064:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83,256,579 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTTATTCAGACCTTCTCACATGG -3'
(R):5'- TTCTCCAGAGTCAAGGCAGACAG -3'

Sequencing Primer
(F):5'- CAGACCTTCTCACATGGACTTAG -3'
(R):5'- CCTGAGTTGACTGGAGCACATTC -3'
Posted On 2019-11-26