Incidental Mutation 'R7753:Qrich2'
ID597384
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Nameglutamine rich 2
SynonymsLOC217341
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7753 (G1)
Quality Score153.468
Status Not validated
Chromosome11
Chromosomal Location116441325-116466241 bp(-) (GRCm38)
Type of Mutationsmall deletion (10 aa in frame mutation)
DNA Base Change (assembly) TTGCAACACACCAGGCTGAACTGGACCTTGCTG to TTG at 116457042 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093909] [ENSMUST00000208602]
Predicted Effect probably benign
Transcript: ENSMUST00000093909
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208602
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,184,107 T1377A probably damaging Het
AI661453 G T 17: 47,467,514 E722* probably null Het
Ap2b1 A T 11: 83,367,907 K735* probably null Het
Aqp4 T C 18: 15,399,976 E20G probably benign Het
Atp6v1b1 G T 6: 83,752,458 V117L probably benign Het
C1rb A G 6: 124,580,431 N509S probably benign Het
Cep44 A G 8: 56,532,807 V350A probably benign Het
Cmya5 T C 13: 93,098,172 Q136R probably benign Het
Cntrl T C 2: 35,111,679 S32P probably damaging Het
Cyp2d12 A T 15: 82,556,963 E201V possibly damaging Het
Cyp4a14 G T 4: 115,493,664 Q138K probably damaging Het
Dapk1 T C 13: 60,751,193 Y826H possibly damaging Het
Dbh A G 2: 27,171,436 D294G probably benign Het
Ddx10 A T 9: 53,225,604 L336Q probably damaging Het
Dopey1 A G 9: 86,489,702 T149A possibly damaging Het
Epg5 A G 18: 77,948,345 T86A possibly damaging Het
Fam171a1 A T 2: 3,178,317 Q60L probably damaging Het
Farsb T A 1: 78,480,103 E41D probably benign Het
Frem1 T C 4: 82,913,980 D1956G probably benign Het
Fzd4 T A 7: 89,407,784 Y346* probably null Het
Fzd7 A T 1: 59,483,482 S175C probably benign Het
Gdi2 A G 13: 3,548,956 T47A probably benign Het
Gm8765 A T 13: 50,701,781 D485V probably damaging Het
Gpr155 A T 2: 73,382,206 H24Q probably benign Het
Hdac7 A T 15: 97,800,761 N638K possibly damaging Het
Hdac7 G T 15: 97,806,488 N515K probably benign Het
Hnrnpul2 T C 19: 8,824,972 V401A probably damaging Het
Ifi27l2b T A 12: 103,451,260 R223* probably null Het
Igkv4-91 T G 6: 68,768,777 S46R probably benign Het
Itk T A 11: 46,331,895 L582F probably damaging Het
Kcnab2 T C 4: 152,396,761 I181V probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCTCC GCCACAGCCTCC 7: 142,175,399 probably benign Het
Lce1m C A 3: 93,018,508 G41W unknown Het
Mapk10 T A 5: 103,038,553 K98* probably null Het
Mapk8ip2 A G 15: 89,461,653 E812G probably damaging Het
Mlh1 C A 9: 111,252,863 probably null Het
Mroh1 A G 15: 76,433,275 D784G possibly damaging Het
Neo1 A T 9: 58,956,005 D426E probably benign Het
Nol4 T A 18: 23,038,602 M1L probably benign Het
Nr1h3 A G 2: 91,185,025 F338S probably damaging Het
Oasl2 A G 5: 114,905,057 K297E probably benign Het
Olfr1030 A G 2: 85,984,716 N292S possibly damaging Het
Olfr1129 A G 2: 87,575,797 T238A probably benign Het
Olfr1306 A G 2: 111,912,582 I116T probably benign Het
Olfr419 C T 1: 174,250,670 V86I probably benign Het
Olfr683 T C 7: 105,143,800 I164M probably benign Het
Osbpl9 T C 4: 109,133,773 T97A possibly damaging Het
P3h2 A T 16: 25,970,937 Y527N probably damaging Het
Papss2 A T 19: 32,620,179 H9L probably benign Het
Pcdha4 C A 18: 36,953,301 S179Y possibly damaging Het
Ppt1 A T 4: 122,836,338 D28V possibly damaging Het
Prkcz T A 4: 155,272,968 Q345L possibly damaging Het
Prr14l G T 5: 32,827,253 L1633I probably damaging Het
Prss51 T A 14: 64,095,927 V13D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slc2a7 T C 4: 150,154,684 I122T possibly damaging Het
Sprr3 G A 3: 92,457,108 P143L probably benign Het
Sugct A T 13: 17,577,519 S181T possibly damaging Het
Syne2 G A 12: 76,038,923 R141Q probably benign Het
Taok1 T C 11: 77,537,899 I992V probably benign Het
Tbc1d21 A C 9: 58,362,023 probably null Het
Thada T C 17: 84,252,390 D1453G probably damaging Het
Thoc5 T C 11: 4,902,156 L104S probably damaging Het
Tln2 T G 9: 67,395,473 Y72S probably damaging Het
Tmem98 A G 11: 80,814,311 E75G probably damaging Het
Tox3 A G 8: 90,248,932 L357P probably damaging Het
Ubr4 T C 4: 139,470,292 V4492A unknown Het
Ulk4 A G 9: 121,266,512 probably null Het
Ush2a A G 1: 188,443,406 T1234A probably benign Het
Usp53 G A 3: 122,949,238 T683I probably damaging Het
Vcan T A 13: 89,689,323 I2701F probably damaging Het
Vmn2r72 G A 7: 85,750,626 A405V probably damaging Het
Vmn2r96 A T 17: 18,586,401 T537S possibly damaging Het
Vstm2a G T 11: 16,263,040 A142S probably damaging Het
Zbtb41 A G 1: 139,447,157 D785G probably benign Het
Zfp397 A T 18: 23,957,072 Q144H probably benign Het
Zfp518a A T 19: 40,915,805 T1393S possibly damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116456199 small deletion probably benign
R0122:Qrich2 UTSW 11 116446813 missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116441395 missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116441485 missense probably benign 0.08
R1786:Qrich2 UTSW 11 116441449 missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116447156 missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116448417 splice site probably benign
R2178:Qrich2 UTSW 11 116443777 missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116445651 missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116446915 missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116446773 missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116447150 missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116448365 missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116445948 critical splice donor site probably null
R5589:Qrich2 UTSW 11 116441408 missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116445002 missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116447006 intron probably benign
R6183:Qrich2 UTSW 11 116458129 unclassified probably benign
R6193:Qrich2 UTSW 11 116454153 missense probably benign 0.07
R6211:Qrich2 UTSW 11 116453542 missense probably benign 0.41
R6375:Qrich2 UTSW 11 116458228 unclassified probably benign
R6452:Qrich2 UTSW 11 116455888 missense probably benign 0.01
R6870:Qrich2 UTSW 11 116455330 missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116446875 missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116456254 missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116455721 missense probably benign 0.00
R7586:Qrich2 UTSW 11 116455624 missense probably benign 0.43
R7588:Qrich2 UTSW 11 116465937 missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116456629 missense unknown
R7638:Qrich2 UTSW 11 116455322 missense probably benign 0.00
R7736:Qrich2 UTSW 11 116457541 small deletion probably benign
R7737:Qrich2 UTSW 11 116457541 small deletion probably benign
R7800:Qrich2 UTSW 11 116456860 nonsense probably null
R7833:Qrich2 UTSW 11 116455765 missense probably benign 0.04
R7912:Qrich2 UTSW 11 116455782 small deletion probably benign
R7923:Qrich2 UTSW 11 116457337 missense probably damaging 1.00
R8197:Qrich2 UTSW 11 116457035 small deletion probably benign
R8225:Qrich2 UTSW 11 116454068 missense probably damaging 1.00
R8300:Qrich2 UTSW 11 116456349 missense probably benign 0.04
R8391:Qrich2 UTSW 11 116465577 missense probably benign 0.00
R8705:Qrich2 UTSW 11 116457541 small deletion probably benign
R8792:Qrich2 UTSW 11 116456630 missense unknown
R8912:Qrich2 UTSW 11 116457541 small deletion probably benign
R8937:Qrich2 UTSW 11 116457245 small deletion probably benign
R9025:Qrich2 UTSW 11 116457541 small deletion probably benign
Z1176:Qrich2 UTSW 11 116456378 missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116456668 missense unknown
Predicted Primers PCR Primer
(F):5'- TATACCAGGCTGGACCATGC -3'
(R):5'- AGTTCAGTTTGGCATGGTCCAG -3'

Sequencing Primer
(F):5'- AGGCTGAACTGCACCTGATTG -3'
(R):5'- AGCCGGGTGCAGTTGAG -3'
Posted On2019-11-26