Incidental Mutation 'R7754:Zbtb8a'
ID597430
Institutional Source Beutler Lab
Gene Symbol Zbtb8a
Ensembl Gene ENSMUSG00000028807
Gene Namezinc finger and BTB domain containing 8a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129353628-129378116 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 129357703 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030610] [ENSMUST00000146767]
Predicted Effect probably null
Transcript: ENSMUST00000030610
SMART Domains Protein: ENSMUSP00000030610
Gene: ENSMUSG00000028807

DomainStartEndE-ValueType
BTB 24 122 2.49e-25 SMART
ZnF_C2H2 275 297 2.2e-2 SMART
ZnF_C2H2 303 326 4.17e-3 SMART
low complexity region 422 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146767
SMART Domains Protein: ENSMUSP00000114628
Gene: ENSMUSG00000057572

DomainStartEndE-ValueType
Pfam:Archease 31 145 3.5e-40 PFAM
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Zbtb8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Zbtb8a APN 4 129357847 missense probably damaging 1.00
PIT4514001:Zbtb8a UTSW 4 129357730 missense probably benign 0.01
R1033:Zbtb8a UTSW 4 129354221 missense possibly damaging 0.82
R1183:Zbtb8a UTSW 4 129357727 missense possibly damaging 0.94
R1755:Zbtb8a UTSW 4 129354317 missense possibly damaging 0.71
R2426:Zbtb8a UTSW 4 129360219 missense probably benign 0.00
R2520:Zbtb8a UTSW 4 129359896 critical splice donor site probably null
R5044:Zbtb8a UTSW 4 129360500 missense probably damaging 1.00
R6357:Zbtb8a UTSW 4 129354299 missense probably benign
R7129:Zbtb8a UTSW 4 129360395 missense probably damaging 1.00
R7352:Zbtb8a UTSW 4 129360081 missense probably benign 0.00
T0722:Zbtb8a UTSW 4 129360019 small insertion probably benign
T0722:Zbtb8a UTSW 4 129360212 missense probably benign
T0975:Zbtb8a UTSW 4 129360019 small insertion probably benign
T0975:Zbtb8a UTSW 4 129360212 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTACTTCAGGGCCTCAAATGAG -3'
(R):5'- TCCTGACAGATGACCTGACC -3'

Sequencing Primer
(F):5'- AACTCACTCTGTAGACCAGGTTGG -3'
(R):5'- ACCAGGCTTCGGTTCAAATG -3'
Posted On2019-11-26