Incidental Mutation 'R7754:Gtf3c2'
ID597433
Institutional Source Beutler Lab
Gene Symbol Gtf3c2
Ensembl Gene ENSMUSG00000106864
Gene Namegeneral transcription factor IIIC, polypeptide 2, beta
SynonymsTFIIIC110, 2610510G03Rik, TFIIIC-BETA, 1300004C11Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31156005-31180144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31172831 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 265 (D265G)
Ref Sequence ENSEMBL: ENSMUSP00000085325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088010] [ENSMUST00000101411] [ENSMUST00000200871] [ENSMUST00000201428] [ENSMUST00000201468] [ENSMUST00000202300] [ENSMUST00000202639]
Predicted Effect probably benign
Transcript: ENSMUST00000088010
AA Change: D265G

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085325
Gene: ENSMUSG00000106864
AA Change: D265G

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
WD40 821 861 5.33e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101411
AA Change: D265G

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098957
Gene: ENSMUSG00000101678
AA Change: D265G

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
Blast:WD40 807 844 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000200871
Predicted Effect probably benign
Transcript: ENSMUST00000201428
SMART Domains Protein: ENSMUSP00000144212
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201468
SMART Domains Protein: ENSMUSP00000144675
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202300
SMART Domains Protein: ENSMUSP00000144249
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202639
AA Change: D308G

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144489
Gene: ENSMUSG00000106864
AA Change: D308G

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Gtf3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Gtf3c2 APN 5 31174408 missense probably damaging 1.00
IGL00832:Gtf3c2 APN 5 31173005 unclassified probably benign
IGL00904:Gtf3c2 APN 5 31172858 missense probably damaging 1.00
IGL00966:Gtf3c2 APN 5 31170173 critical splice donor site probably benign 0.00
IGL01061:Gtf3c2 APN 5 31168354 missense possibly damaging 0.94
IGL01148:Gtf3c2 APN 5 31159824 missense probably damaging 1.00
IGL01767:Gtf3c2 APN 5 31157635 missense probably benign 0.08
IGL02237:Gtf3c2 APN 5 31159053 splice site probably benign
IGL02458:Gtf3c2 APN 5 31159523 critical splice acceptor site probably null
IGL02888:Gtf3c2 APN 5 31173825 missense probably damaging 1.00
IGL03035:Gtf3c2 APN 5 31166014 missense possibly damaging 0.96
IGL03131:Gtf3c2 APN 5 31157620 missense probably damaging 0.98
R0534:Gtf3c2 UTSW 5 31158132 splice site probably benign
R0581:Gtf3c2 UTSW 5 31159518 nonsense probably null
R0634:Gtf3c2 UTSW 5 31159806 nonsense probably null
R1172:Gtf3c2 UTSW 5 31168075 missense probably damaging 1.00
R1511:Gtf3c2 UTSW 5 31159102 missense probably benign 0.15
R1680:Gtf3c2 UTSW 5 31173868 missense probably damaging 1.00
R1726:Gtf3c2 UTSW 5 31169123 missense possibly damaging 0.82
R1831:Gtf3c2 UTSW 5 31168369 missense probably damaging 1.00
R2006:Gtf3c2 UTSW 5 31168096 missense probably damaging 0.99
R2437:Gtf3c2 UTSW 5 31159698 critical splice donor site probably null
R4732:Gtf3c2 UTSW 5 31160057 missense probably damaging 0.97
R4733:Gtf3c2 UTSW 5 31160057 missense probably damaging 0.97
R4787:Gtf3c2 UTSW 5 31157577 missense probably benign 0.03
R4817:Gtf3c2 UTSW 5 31174090 critical splice acceptor site probably null
R4863:Gtf3c2 UTSW 5 31159233 intron probably benign
R4926:Gtf3c2 UTSW 5 31169123 missense possibly damaging 0.82
R5508:Gtf3c2 UTSW 5 31174461 nonsense probably null
R5704:Gtf3c2 UTSW 5 31159110 missense probably damaging 1.00
R5737:Gtf3c2 UTSW 5 31168249 critical splice donor site probably null
R5868:Gtf3c2 UTSW 5 31168081 missense possibly damaging 0.94
R6174:Gtf3c2 UTSW 5 31158211 missense probably damaging 1.00
R6705:Gtf3c2 UTSW 5 31166008 missense possibly damaging 0.93
R6782:Gtf3c2 UTSW 5 31169836 missense probably benign 0.01
R6893:Gtf3c2 UTSW 5 31166378 missense probably benign 0.06
R7363:Gtf3c2 UTSW 5 31170256 missense probably damaging 1.00
R7474:Gtf3c2 UTSW 5 31167756 missense probably damaging 1.00
R7578:Gtf3c2 UTSW 5 31172997 missense probably benign
R7685:Gtf3c2 UTSW 5 31168267 missense probably damaging 1.00
R7711:Gtf3c2 UTSW 5 31170189 missense probably damaging 1.00
R7825:Gtf3c2 UTSW 5 31158371 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACTCCAGAGTGAACAATCTAGAC -3'
(R):5'- TGTCTGGTCCTAAGAGTCCC -3'

Sequencing Primer
(F):5'- GTATAGTGTCTCCAAATACCTTGCAC -3'
(R):5'- TGGTCCTAAGAGTCCCAAGGTG -3'
Posted On2019-11-26