Incidental Mutation 'R7754:Gpr37'
ID597436
Institutional Source Beutler Lab
Gene Symbol Gpr37
Ensembl Gene ENSMUSG00000039904
Gene NameG protein-coupled receptor 37
Synonymsparkin-associated endothelin B-like receptor, Pael-R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location25665878-25690729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25689050 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 16 (L16H)
Ref Sequence ENSEMBL: ENSMUSP00000052185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]
Predicted Effect probably damaging
Transcript: ENSMUST00000054867
AA Change: L16H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: L16H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 536 5.2e-33 PFAM
low complexity region 549 558 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200812
AA Change: L16H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904
AA Change: L16H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 421 3.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Gpr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Gpr37 APN 6 25669318 missense possibly damaging 0.65
IGL01595:Gpr37 APN 6 25669573 missense probably damaging 1.00
IGL01670:Gpr37 APN 6 25669834 missense probably damaging 1.00
IGL02552:Gpr37 APN 6 25688687 missense probably benign 0.05
IGL03331:Gpr37 APN 6 25669729 missense probably benign 0.26
R0375:Gpr37 UTSW 6 25669291 missense probably benign 0.08
R0534:Gpr37 UTSW 6 25669824 nonsense probably null
R0892:Gpr37 UTSW 6 25688207 missense probably damaging 1.00
R1481:Gpr37 UTSW 6 25669138 missense probably damaging 0.99
R1700:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R2083:Gpr37 UTSW 6 25688417 missense possibly damaging 0.62
R2089:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2112:Gpr37 UTSW 6 25669381 missense possibly damaging 0.91
R2847:Gpr37 UTSW 6 25666946 unclassified probably benign
R2848:Gpr37 UTSW 6 25666946 unclassified probably benign
R4119:Gpr37 UTSW 6 25688426 missense possibly damaging 0.90
R4611:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R4734:Gpr37 UTSW 6 25689086 missense possibly damaging 0.53
R4765:Gpr37 UTSW 6 25669108 missense probably damaging 1.00
R5163:Gpr37 UTSW 6 25669615 missense possibly damaging 0.87
R5669:Gpr37 UTSW 6 25669352 missense probably benign 0.05
R6548:Gpr37 UTSW 6 25688813 missense probably benign 0.32
R6760:Gpr37 UTSW 6 25669169 missense probably benign 0.00
R7030:Gpr37 UTSW 6 25689005 missense possibly damaging 0.92
R7278:Gpr37 UTSW 6 25669342 missense possibly damaging 0.68
R7392:Gpr37 UTSW 6 25688787 missense probably benign 0.34
R7726:Gpr37 UTSW 6 25669117 missense possibly damaging 0.94
R7757:Gpr37 UTSW 6 25688208 missense probably benign 0.26
V7732:Gpr37 UTSW 6 25669123 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTCTCTGGGCACATGGAC -3'
(R):5'- GCTCAGAACATGAAACGTGG -3'

Sequencing Primer
(F):5'- TGGGCACATGGACTCGCAG -3'
(R):5'- GATGACACCGTCCTTCCCCAAG -3'
Posted On2019-11-26