Incidental Mutation 'R7754:Ccdc162'
ID597450
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41587375 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1457 (P1457Q)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000179614] [ENSMUST00000189488] [ENSMUST00000219054]
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099932
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179614
AA Change: P184Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135966
Gene: ENSMUSG00000075225
AA Change: P184Q

DomainStartEndE-ValueType
coiled coil region 517 556 N/A INTRINSIC
low complexity region 680 702 N/A INTRINSIC
coiled coil region 741 797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189488
AA Change: P1457Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: P1457Q

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219054
AA Change: P184Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41586379 missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41580247 missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4112:Ccdc162 UTSW 10 41656328 missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5808:Ccdc162 UTSW 10 41655504 missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41561163 missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41627149 missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41556001 missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41634048 missense probably benign
R7712:Ccdc162 UTSW 10 41627227 missense possibly damaging 0.56
R7726:Ccdc162 UTSW 10 41553075 missense probably benign 0.00
R7764:Ccdc162 UTSW 10 41690113 missense possibly damaging 0.95
R8053:Ccdc162 UTSW 10 41644581 missense probably benign
R8088:Ccdc162 UTSW 10 41623414 missense possibly damaging 0.68
R8094:Ccdc162 UTSW 10 41612868 missense probably benign 0.02
R8097:Ccdc162 UTSW 10 41634119 missense probably benign 0.03
Z1176:Ccdc162 UTSW 10 41553131 missense probably benign 0.00
Z1176:Ccdc162 UTSW 10 41605108 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41654997 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41690092 missense probably benign 0.00
Z1177:Ccdc162 UTSW 10 41683195 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTTTACAGTCAAGGCCAGCAG -3'
(R):5'- AATGAGTCATCGGAGTGGGC -3'

Sequencing Primer
(F):5'- GAGAGCATGGTTTTCTCCATAATAAG -3'
(R):5'- CATCGGAGTGGGCTTTGGAG -3'
Posted On2019-11-26