Incidental Mutation 'R7754:Pld2'
ID597454
Institutional Source Beutler Lab
Gene Symbol Pld2
Ensembl Gene ENSMUSG00000020828
Gene Namephospholipase D2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70540064-70558110 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 70552869 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018429] [ENSMUST00000108557]
Predicted Effect probably null
Transcript: ENSMUST00000018429
SMART Domains Protein: ENSMUSP00000018429
Gene: ENSMUSG00000020828

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 751 778 4.12e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108557
SMART Domains Protein: ENSMUSP00000104197
Gene: ENSMUSG00000020828

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 762 789 4.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130678
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene is a member of the phospholipase D (PLD) superfamily. The encoded protein catalyzes the hydrolysis of phosphatidylcholine to phosphatidic acid and choline. Phosphatidic acid is an essential intracellular lipid second messenger for many signaling pathways and has been implicated in a variety of physiological processes including cytoskeletal organization and cell proliferation. A similar gene in human may also function as a guanine nucleotide exchange factor (GEF) for the small GTPase Rac2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out fail to exhibit Abeta42 suppression of LTP and show altered brain phosphatidic acid levels. Mice homozygous for a different knock-out allele show normal platelet function, hemostasis and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Pld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Pld2 APN 11 70551180 nonsense probably null
IGL01094:Pld2 APN 11 70541306 missense probably damaging 0.99
IGL01696:Pld2 APN 11 70542780 missense probably damaging 1.00
IGL02165:Pld2 APN 11 70555677 missense probably damaging 1.00
IGL02477:Pld2 APN 11 70540925 missense possibly damaging 0.60
IGL02712:Pld2 APN 11 70557079 missense probably benign 0.44
IGL03013:Pld2 APN 11 70541177 missense probably damaging 1.00
R0117:Pld2 UTSW 11 70557388 missense probably benign 0.19
R0130:Pld2 UTSW 11 70554348 missense probably benign
R0508:Pld2 UTSW 11 70552542 missense probably damaging 0.98
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0974:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R1907:Pld2 UTSW 11 70544184 missense probably damaging 0.99
R2087:Pld2 UTSW 11 70542960 missense probably damaging 1.00
R2181:Pld2 UTSW 11 70542989 missense possibly damaging 0.70
R2379:Pld2 UTSW 11 70554314 missense probably benign 0.01
R3772:Pld2 UTSW 11 70544123 unclassified probably benign
R3949:Pld2 UTSW 11 70553354 missense probably benign
R4028:Pld2 UTSW 11 70554905 missense probably damaging 1.00
R4029:Pld2 UTSW 11 70554905 missense probably damaging 1.00
R4160:Pld2 UTSW 11 70541427 missense probably damaging 1.00
R4428:Pld2 UTSW 11 70541334 missense probably damaging 1.00
R4595:Pld2 UTSW 11 70542020 missense probably damaging 1.00
R4945:Pld2 UTSW 11 70555698 missense probably damaging 1.00
R5280:Pld2 UTSW 11 70552759 missense probably damaging 1.00
R5659:Pld2 UTSW 11 70557561 makesense probably null
R5773:Pld2 UTSW 11 70555932 missense probably damaging 1.00
R5900:Pld2 UTSW 11 70556062 critical splice donor site probably null
R6249:Pld2 UTSW 11 70555370 missense probably damaging 1.00
R6362:Pld2 UTSW 11 70554675 missense probably damaging 1.00
R6746:Pld2 UTSW 11 70541107 missense probably damaging 0.96
R6922:Pld2 UTSW 11 70553447 missense probably benign 0.02
R7213:Pld2 UTSW 11 70553372 missense probably benign 0.02
R8122:Pld2 UTSW 11 70541433 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTACTCTAGGTGATGCGACAC -3'
(R):5'- CCCTCTTCAACTGCAGTTAGAG -3'

Sequencing Primer
(F):5'- ACCCAGACCTTGTGACACTGTG -3'
(R):5'- ATAGGATCCCATGGTGTAGCC -3'
Posted On2019-11-26