Incidental Mutation 'R7754:Wscd1'
ID597455
Institutional Source Beutler Lab
Gene Symbol Wscd1
Ensembl Gene ENSMUSG00000020811
Gene NameWSC domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location71749920-71789647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71784365 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 366 (H366R)
Ref Sequence ENSEMBL: ENSMUSP00000021168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021168] [ENSMUST00000108510] [ENSMUST00000108511]
Predicted Effect probably damaging
Transcript: ENSMUST00000021168
AA Change: H366R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021168
Gene: ENSMUSG00000020811
AA Change: H366R

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
WSC 139 231 8.72e-40 SMART
WSC 242 337 2.09e-28 SMART
Pfam:Sulfotransfer_1 413 525 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108510
AA Change: H366R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104150
Gene: ENSMUSG00000020811
AA Change: H366R

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
WSC 139 231 8.72e-40 SMART
WSC 242 337 2.09e-28 SMART
Pfam:Sulfotransfer_1 413 525 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108511
AA Change: H366R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104151
Gene: ENSMUSG00000020811
AA Change: H366R

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
WSC 139 231 8.72e-40 SMART
WSC 242 337 2.09e-28 SMART
Pfam:Sulfotransfer_1 413 525 1.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Wscd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Wscd1 APN 11 71788942 missense possibly damaging 0.89
IGL01982:Wscd1 APN 11 71766873 missense possibly damaging 0.94
IGL01991:Wscd1 APN 11 71787723 nonsense probably null
IGL02211:Wscd1 APN 11 71788975 missense probably damaging 1.00
R0011:Wscd1 UTSW 11 71788828 missense probably damaging 1.00
R0011:Wscd1 UTSW 11 71788828 missense probably damaging 1.00
R0359:Wscd1 UTSW 11 71766866 missense probably damaging 1.00
R0371:Wscd1 UTSW 11 71788723 missense probably damaging 1.00
R1340:Wscd1 UTSW 11 71768760 missense probably benign 0.01
R1429:Wscd1 UTSW 11 71760174 missense probably damaging 0.99
R1511:Wscd1 UTSW 11 71788675 missense probably damaging 1.00
R1823:Wscd1 UTSW 11 71760218 missense probably benign 0.05
R4772:Wscd1 UTSW 11 71771976 critical splice donor site probably null
R4885:Wscd1 UTSW 11 71760146 missense probably damaging 1.00
R5221:Wscd1 UTSW 11 71768675 missense possibly damaging 0.53
R5714:Wscd1 UTSW 11 71784435 critical splice donor site probably null
R6351:Wscd1 UTSW 11 71759883 missense probably damaging 1.00
R7181:Wscd1 UTSW 11 71759883 missense probably damaging 1.00
R7184:Wscd1 UTSW 11 71788717 missense probably damaging 1.00
R7461:Wscd1 UTSW 11 71759973 missense possibly damaging 0.95
R7613:Wscd1 UTSW 11 71759973 missense possibly damaging 0.95
R7875:Wscd1 UTSW 11 71788734 missense probably damaging 1.00
R7958:Wscd1 UTSW 11 71788734 missense probably damaging 1.00
Z1177:Wscd1 UTSW 11 71788800 nonsense probably null
Z1177:Wscd1 UTSW 11 71788985 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTCCCTGTCCAGAGGA -3'
(R):5'- TAGCGTTCCAAGGAGGGCT -3'

Sequencing Primer
(F):5'- CACAGACAGGAAGTTCCT -3'
(R):5'- CAGATTCCACGTGGCTTTAACTAG -3'
Posted On2019-11-26