Incidental Mutation 'R7754:Rtn1'
ID597460
Institutional Source Beutler Lab
Gene Symbol Rtn1
Ensembl Gene ENSMUSG00000021087
Gene Namereticulon 1
SynonymsRtn1-c, 0710005K15Rik, Nsp, Rtn1-b, Rtn1-a, 4930441F12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location72211752-72409054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72308429 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 248 (K248E)
Ref Sequence ENSEMBL: ENSMUSP00000077594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078505]
Predicted Effect probably damaging
Transcript: ENSMUST00000078505
AA Change: K248E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077594
Gene: ENSMUSG00000021087
AA Change: K248E

DomainStartEndE-ValueType
low complexity region 135 152 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 438 448 N/A INTRINSIC
low complexity region 473 480 N/A INTRINSIC
low complexity region 574 586 N/A INTRINSIC
Pfam:Reticulon 593 757 2.2e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Rtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Rtn1 APN 12 72408511 missense probably benign 0.18
IGL01335:Rtn1 APN 12 72308350 missense probably benign
IGL01394:Rtn1 APN 12 72308416 missense probably benign 0.00
IGL01551:Rtn1 APN 12 72216935 missense possibly damaging 0.63
IGL01865:Rtn1 APN 12 72219300 missense probably damaging 1.00
IGL02585:Rtn1 APN 12 72308155 critical splice donor site probably null
PIT4802001:Rtn1 UTSW 12 72304326 missense probably benign 0.21
R0104:Rtn1 UTSW 12 72308845 missense probably damaging 0.99
R0866:Rtn1 UTSW 12 72308382 nonsense probably null
R1099:Rtn1 UTSW 12 72304467 intron probably null
R1438:Rtn1 UTSW 12 72304413 missense probably damaging 0.98
R1610:Rtn1 UTSW 12 72219279 missense possibly damaging 0.90
R1694:Rtn1 UTSW 12 72223524 missense probably damaging 1.00
R1869:Rtn1 UTSW 12 72308168 missense probably damaging 1.00
R1888:Rtn1 UTSW 12 72236533 intron probably benign
R1889:Rtn1 UTSW 12 72304410 missense possibly damaging 0.87
R1892:Rtn1 UTSW 12 72212563 missense probably damaging 1.00
R2418:Rtn1 UTSW 12 72304278 missense probably benign
R2760:Rtn1 UTSW 12 72408362 missense probably benign 0.00
R2973:Rtn1 UTSW 12 72223389 missense probably damaging 1.00
R4567:Rtn1 UTSW 12 72212487 utr 3 prime probably benign
R4880:Rtn1 UTSW 12 72217458 missense possibly damaging 0.88
R4945:Rtn1 UTSW 12 72217484 missense probably damaging 1.00
R6183:Rtn1 UTSW 12 72408491 missense probably benign 0.09
R6493:Rtn1 UTSW 12 72308329 missense probably damaging 0.99
R6547:Rtn1 UTSW 12 72308761 missense possibly damaging 0.59
R6602:Rtn1 UTSW 12 72219318 missense probably damaging 0.99
R7474:Rtn1 UTSW 12 72308390 missense possibly damaging 0.87
R7615:Rtn1 UTSW 12 72304143 missense probably damaging 1.00
R7697:Rtn1 UTSW 12 72408377 missense probably benign 0.32
R7748:Rtn1 UTSW 12 72216926 missense possibly damaging 0.53
R7834:Rtn1 UTSW 12 72304032 missense probably damaging 0.99
R7917:Rtn1 UTSW 12 72304032 missense probably damaging 0.99
Z1177:Rtn1 UTSW 12 72308864 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTTGGCTTCAGACACAGGTC -3'
(R):5'- GTGAACAAGATCCTAGCTGACC -3'

Sequencing Primer
(F):5'- GACACAGGTCTTGCTTCTCGG -3'
(R):5'- GATCCTAGCTGACCCCCTAG -3'
Posted On2019-11-26