Incidental Mutation 'R7754:Cacna1d'
ID597464
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R7754 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30075852 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1448 (I1448N)
Ref Sequence ENSEMBL: ENSMUSP00000107869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
Predicted Effect probably damaging
Transcript: ENSMUST00000112249
AA Change: I1426N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: I1426N

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112250
AA Change: I1448N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: I1448N

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223803
AA Change: I1426N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000224198
AA Change: I1461N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: I1426N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000224912
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zc3h18 TGAGGAGGAGGAGGAG TGAGGAGGAGGAG 8: 122,383,857 probably benign Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
Brisk UTSW 14 30171314 missense possibly damaging 0.91
Troppo UTSW 14 30123454 missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 30178645 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
R7066:Cacna1d UTSW 14 30352978 intron probably benign
R7188:Cacna1d UTSW 14 30089833 missense probably benign
R7242:Cacna1d UTSW 14 30178706 missense probably benign 0.00
R7249:Cacna1d UTSW 14 30142703 missense probably damaging 1.00
R7250:Cacna1d UTSW 14 30075151 missense probably damaging 1.00
R7274:Cacna1d UTSW 14 30142643 missense probably damaging 1.00
R7336:Cacna1d UTSW 14 30045282 missense probably benign 0.18
R7343:Cacna1d UTSW 14 30123057 missense probably benign 0.02
R7411:Cacna1d UTSW 14 30352990 start codon destroyed probably null
R7461:Cacna1d UTSW 14 30066163 missense probably benign 0.05
R7534:Cacna1d UTSW 14 30079362 missense probably damaging 1.00
R7613:Cacna1d UTSW 14 30066163 missense probably benign 0.05
R7661:Cacna1d UTSW 14 30047220 missense probably benign 0.07
R7759:Cacna1d UTSW 14 30099188 missense probably benign 0.01
R7784:Cacna1d UTSW 14 30123439 missense probably damaging 1.00
R7808:Cacna1d UTSW 14 30111069 missense probably damaging 1.00
Z1176:Cacna1d UTSW 14 30111116 missense not run
Z1176:Cacna1d UTSW 14 30179188 missense not run
Predicted Primers PCR Primer
(F):5'- AAGACACCTGCCTAGAAGGG -3'
(R):5'- AACGGCATTGCTACAGTTACATAC -3'

Sequencing Primer
(F):5'- GCCCAGAGTATGCCAACTG -3'
(R):5'- GCACAAGCTAAGAATTTTCTTCCC -3'
Posted On2019-11-26