Mutagenetix > Incidental Mutations

Incidental Mutation 'R7754:Pkhd1l1'

597467

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1l1

Ensembl Gene

ENSMUSG00000038725

Gene Name

polycystic kidney and hepatic disease 1-like 1

Synonyms

PKHDL1, D86 mRNA, fibrocystin L

MMRRC Submission

Accession Numbers

Genbank: NM_138674; MGI: 2183153

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7754 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44457494-44601369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44586408 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 3856 (I3856V)

Ref Sequence

ENSEMBL: ENSMUSP00000036988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038336
AA Change: I3856V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: I3856V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	1.6e-16	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1322	1.1e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	5.1e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	2.1e-10	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166957
AA Change: I3856V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: I3856V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	9.4e-18	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1323	3e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	3.7e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	9.7e-12	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209244
AA Change: I3856V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	A	T	2: 91,304,843		probably null	Het
2410089E03Rik	C	A	15: 8,243,826	Q2534K	possibly damaging	Het
4930553M12Rik	A	T	4: 88,868,259	W41R	unknown	Het
Aatf	G	A	11: 84,511,509	S117L	possibly damaging	Het
Abca12	C	A	1: 71,302,887	V972L	probably benign	Het
Abcb11	T	A	2: 69,286,818	R495S	probably damaging	Het
Acss2	T	A	2: 155,561,166	H621Q	probably benign	Het
Akap9	T	C	5: 4,046,736	L2537P	probably benign	Het
Apbb1	C	T	7: 105,559,302	A597T	probably damaging	Het
Cacna1d	A	T	14: 30,075,852	I1448N	probably damaging	Het
Cacna1e	C	T	1: 154,413,117	E1841K	probably damaging	Het
Ccdc162	G	T	10: 41,587,375	P1457Q	probably damaging	Het
Cep70	A	G	9: 99,281,092	K331E	probably damaging	Het
D430041D05Rik	A	T	2: 104,257,159	Y491N	probably benign	Het
Dnah6	T	C	6: 73,025,720	I3898V	probably benign	Het
Drd2	A	G	9: 49,404,977	T346A	probably benign	Het
Efcab9	T	C	11: 32,522,941	T169A	possibly damaging	Het
Fam163a	A	T	1: 156,079,983	I21N	probably damaging	Het
Fam171a2	C	T	11: 102,438,563	D457N	probably benign	Het
Fbn1	A	T	2: 125,479,280		probably null	Het
Gpr37	A	T	6: 25,689,050	L16H	probably damaging	Het
Gtf3c2	T	C	5: 31,172,831	D265G	probably benign	Het
Idh1	G	T	1: 65,159,490	A407D	probably benign	Het
Ifna12	A	G	4: 88,603,178	M44T	probably damaging	Het
Il22ra1	A	G	4: 135,734,250	M109V	probably benign	Het
Jag2	A	T	12: 112,915,469		probably null	Het
Lca5l	T	C	16: 96,159,561	D572G	unknown	Het
Lcn11	G	A	2: 25,777,818	V73I	probably benign	Het
Lrba	A	G	3: 86,445,397	T1951A	probably damaging	Het
Ltbp2	A	G	12: 84,813,238		probably null	Het
Malrd1	G	A	2: 15,797,799		probably null	Het
Morc2b	C	A	17: 33,137,244	G518V	probably benign	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Myo5b	A	T	18: 74,634,559	T313S	probably benign	Het
Neto2	C	A	8: 85,669,700	L140F	probably damaging	Het
Nlgn1	C	T	3: 25,434,303	V623I	probably damaging	Het
Olfr364-ps1	A	G	2: 37,146,846	I211M	possibly damaging	Het
Olfr371	T	A	8: 85,230,798	M101K	possibly damaging	Het
Olfr384	C	T	11: 73,603,506	Q309*	probably null	Het
Olfr603	C	A	7: 103,383,738	W88L	probably damaging	Het
Olfr825	T	G	10: 130,162,829	T166P	probably damaging	Het
Optc	A	G	1: 133,906,992	S15P	possibly damaging	Het
Otogl	A	G	10: 107,869,546	V640A	probably damaging	Het
Pcdhgb2	T	C	18: 37,689,970	S5P	probably benign	Het
Pde3a	A	T	6: 141,459,249	E400V	probably benign	Het
Pld2	G	A	11: 70,552,869		probably null	Het
Plxna4	G	T	6: 32,152,872	H1839N	probably damaging	Het
Ppp6r2	T	C	15: 89,256,701	V89A	probably benign	Het
Rapgef3	T	C	15: 97,757,746	D420G	probably damaging	Het
Rnf17	T	A	14: 56,462,072		probably null	Het
Rps6ka2	T	A	17: 7,277,449		probably null	Het
Rptn	A	T	3: 93,395,921	D187V	probably damaging	Het
Rtn1	T	C	12: 72,308,429	K248E	probably damaging	Het
Rtn4rl1	A	T	11: 75,265,045	H101L	probably benign	Het
Sept3	A	G	15: 82,290,773	N305S	probably benign	Het
Serpina3f	G	T	12: 104,217,306	K142N	possibly damaging	Het
Ssh1	C	A	5: 113,966,234	R116L	probably benign	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tlr6	T	C	5: 64,954,350	K405E	possibly damaging	Het
Trbv13-2	G	A	6: 41,121,700	A70T	probably benign	Het
Ttn	A	T	2: 76,825,505		probably null	Het
Ttn	A	T	2: 76,788,196	I16248N	probably damaging	Het
Vldlr	A	T	19: 27,217,615	M1L	probably benign	Het
Wscd1	A	G	11: 71,784,365	H366R	probably damaging	Het
Zbtb8a	A	G	4: 129,357,703		probably null	Het
Zfp827	T	C	8: 79,190,329	V511A		Het

Other mutations in Pkhd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Pkhd1l1	APN	15	44477586	missense	probably damaging	1.00
IGL00235:Pkhd1l1	APN	15	44556019	missense	probably damaging	1.00
IGL00264:Pkhd1l1	APN	15	44491029	missense	possibly damaging	0.67
IGL00537:Pkhd1l1	APN	15	44591992	missense	possibly damaging	0.88
IGL00537:Pkhd1l1	APN	15	44500047	missense	probably benign	0.42
IGL00580:Pkhd1l1	APN	15	44586474	missense	probably damaging	0.98
IGL01085:Pkhd1l1	APN	15	44562752	splice site	probably null
IGL01089:Pkhd1l1	APN	15	44483869	splice site	probably benign
IGL01094:Pkhd1l1	APN	15	44546929	missense	probably benign	0.09
IGL01120:Pkhd1l1	APN	15	44505312	critical splice donor site	probably null
IGL01307:Pkhd1l1	APN	15	44530029	missense	possibly damaging	0.82
IGL01362:Pkhd1l1	APN	15	44532982	missense	probably benign	0.00
IGL01403:Pkhd1l1	APN	15	44483833	nonsense	probably null
IGL01546:Pkhd1l1	APN	15	44566316	missense	probably damaging	1.00
IGL01596:Pkhd1l1	APN	15	44529410	missense	possibly damaging	0.50
IGL01696:Pkhd1l1	APN	15	44529351	missense	possibly damaging	0.79
IGL01844:Pkhd1l1	APN	15	44499400	splice site	probably benign
IGL02007:Pkhd1l1	APN	15	44533733	splice site	probably benign
IGL02041:Pkhd1l1	APN	15	44493056	splice site	probably null
IGL02171:Pkhd1l1	APN	15	44516146	missense	possibly damaging	0.80
IGL02206:Pkhd1l1	APN	15	44512849	missense	probably benign	0.08
IGL02266:Pkhd1l1	APN	15	44573614	missense	probably damaging	1.00
IGL02487:Pkhd1l1	APN	15	44459426	missense	possibly damaging	0.65
IGL02488:Pkhd1l1	APN	15	44558597	missense	probably benign
IGL02522:Pkhd1l1	APN	15	44555902	missense	possibly damaging	0.71
IGL02554:Pkhd1l1	APN	15	44578500	missense	probably damaging	1.00
IGL02566:Pkhd1l1	APN	15	44526054	splice site	probably null
IGL02602:Pkhd1l1	APN	15	44557931	missense	probably damaging	1.00
IGL02606:Pkhd1l1	APN	15	44589456	missense	probably benign	0.00
IGL02623:Pkhd1l1	APN	15	44584873	missense	probably damaging	1.00
IGL02634:Pkhd1l1	APN	15	44539667	missense	probably damaging	1.00
IGL02637:Pkhd1l1	APN	15	44564324	missense	probably damaging	1.00
IGL02651:Pkhd1l1	APN	15	44483814	missense	probably damaging	1.00
IGL02679:Pkhd1l1	APN	15	44530045	critical splice donor site	probably null
IGL02684:Pkhd1l1	APN	15	44516209	critical splice donor site	probably null
IGL02739:Pkhd1l1	APN	15	44540950	missense	probably benign	0.11
IGL02831:Pkhd1l1	APN	15	44501493	missense	probably benign	0.18
IGL02839:Pkhd1l1	APN	15	44529543	missense	probably damaging	0.98
IGL02944:Pkhd1l1	APN	15	44501531	missense	probably damaging	1.00
IGL02957:Pkhd1l1	APN	15	44512908	missense	probably damaging	1.00
IGL03001:Pkhd1l1	APN	15	44558004	missense	probably damaging	1.00
IGL03030:Pkhd1l1	APN	15	44591976	missense	probably benign	0.00
IGL03030:Pkhd1l1	APN	15	44596902	missense	probably benign	0.41
IGL03132:Pkhd1l1	APN	15	44574617	missense	probably damaging	1.00
IGL03194:Pkhd1l1	APN	15	44518135	missense	probably damaging	1.00
IGL03219:Pkhd1l1	APN	15	44596895	missense	possibly damaging	0.62
IGL03236:Pkhd1l1	APN	15	44581826	missense	probably damaging	1.00
IGL03266:Pkhd1l1	APN	15	44538952	missense	probably damaging	1.00
IGL03276:Pkhd1l1	APN	15	44594584	missense	possibly damaging	0.77
IGL03284:Pkhd1l1	APN	15	44547518	splice site	probably benign
IGL03377:Pkhd1l1	APN	15	44484351	splice site	probably null
K7371:Pkhd1l1	UTSW	15	44537442	missense	possibly damaging	0.67
K7371:Pkhd1l1	UTSW	15	44500067	missense	possibly damaging	0.94
N/A - 287:Pkhd1l1	UTSW	15	44582258	missense	probably damaging	0.98
P4717OSA:Pkhd1l1	UTSW	15	44523499	missense	probably benign	0.17
P4717OSA:Pkhd1l1	UTSW	15	44528247	missense	probably damaging	1.00
R0007:Pkhd1l1	UTSW	15	44574398	splice site	probably benign
R0020:Pkhd1l1	UTSW	15	44556872	missense	probably damaging	1.00
R0034:Pkhd1l1	UTSW	15	44504009	missense	probably benign	0.00
R0040:Pkhd1l1	UTSW	15	44573625	missense	probably damaging	1.00
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0086:Pkhd1l1	UTSW	15	44556008	missense	possibly damaging	0.94
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0127:Pkhd1l1	UTSW	15	44554605	missense	probably damaging	0.99
R0226:Pkhd1l1	UTSW	15	44526784	missense	possibly damaging	0.65
R0268:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0294:Pkhd1l1	UTSW	15	44560435	missense	probably benign	0.05
R0310:Pkhd1l1	UTSW	15	44522738	splice site	probably benign
R0344:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0449:Pkhd1l1	UTSW	15	44501519	missense	probably damaging	1.00
R0492:Pkhd1l1	UTSW	15	44519690	missense	probably benign	0.03
R0505:Pkhd1l1	UTSW	15	44589418	missense	probably damaging	1.00
R0529:Pkhd1l1	UTSW	15	44526754	missense	possibly damaging	0.62
R0543:Pkhd1l1	UTSW	15	44523491	critical splice acceptor site	probably null
R0552:Pkhd1l1	UTSW	15	44489546	missense	probably damaging	0.98
R0558:Pkhd1l1	UTSW	15	44484424	missense	probably damaging	0.97
R0609:Pkhd1l1	UTSW	15	44467424	missense	possibly damaging	0.48
R0619:Pkhd1l1	UTSW	15	44483838	missense	probably damaging	1.00
R0727:Pkhd1l1	UTSW	15	44535788	missense	possibly damaging	0.80
R0787:Pkhd1l1	UTSW	15	44529264	missense	probably damaging	1.00
R0846:Pkhd1l1	UTSW	15	44495597	missense	probably damaging	1.00
R0909:Pkhd1l1	UTSW	15	44538883	splice site	probably null
R0942:Pkhd1l1	UTSW	15	44532959	missense	probably benign	0.01
R1056:Pkhd1l1	UTSW	15	44591964	missense	probably damaging	1.00
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1187:Pkhd1l1	UTSW	15	44498051	missense	possibly damaging	0.65
R1328:Pkhd1l1	UTSW	15	44497996	missense	probably benign	0.01
R1331:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1331:Pkhd1l1	UTSW	15	44589597	missense	probably damaging	1.00
R1332:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1335:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1338:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1440:Pkhd1l1	UTSW	15	44540988	splice site	probably benign
R1445:Pkhd1l1	UTSW	15	44505644	missense	probably benign	0.32
R1458:Pkhd1l1	UTSW	15	44516115	missense	probably benign	0.01
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1500:Pkhd1l1	UTSW	15	44545494	missense	probably damaging	1.00
R1528:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1542:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R1568:Pkhd1l1	UTSW	15	44545501	splice site	probably null
R1571:Pkhd1l1	UTSW	15	44526841	missense	probably benign
R1572:Pkhd1l1	UTSW	15	44543473	missense	probably benign	0.01
R1604:Pkhd1l1	UTSW	15	44467367	nonsense	probably null
R1638:Pkhd1l1	UTSW	15	44597117	missense	probably benign	0.06
R1639:Pkhd1l1	UTSW	15	44540955	missense	probably damaging	0.99
R1737:Pkhd1l1	UTSW	15	44547509	critical splice donor site	probably null
R1816:Pkhd1l1	UTSW	15	44528239	missense	possibly damaging	0.91
R1826:Pkhd1l1	UTSW	15	44503345	missense	possibly damaging	0.75
R1880:Pkhd1l1	UTSW	15	44525242	missense	probably benign	0.13
R1930:Pkhd1l1	UTSW	15	44503337	missense	possibly damaging	0.69
R1933:Pkhd1l1	UTSW	15	44540884	missense	possibly damaging	0.48
R1938:Pkhd1l1	UTSW	15	44500038	missense	probably benign
R1975:Pkhd1l1	UTSW	15	44529713	missense	probably damaging	1.00
R1999:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2037:Pkhd1l1	UTSW	15	44568221	splice site	probably null
R2045:Pkhd1l1	UTSW	15	44479654	missense	probably damaging	1.00
R2049:Pkhd1l1	UTSW	15	44547513	splice site	probably benign
R2049:Pkhd1l1	UTSW	15	44581741	missense	probably damaging	1.00
R2063:Pkhd1l1	UTSW	15	44550752	missense	possibly damaging	0.69
R2072:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2073:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2075:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2078:Pkhd1l1	UTSW	15	44527767	missense	probably benign	0.08
R2116:Pkhd1l1	UTSW	15	44569482	missense	probably damaging	0.97
R2133:Pkhd1l1	UTSW	15	44516185	missense	possibly damaging	0.91
R2138:Pkhd1l1	UTSW	15	44501457	missense	probably damaging	1.00
R2139:Pkhd1l1	UTSW	15	44529818	missense	possibly damaging	0.46
R2145:Pkhd1l1	UTSW	15	44512877	splice site	probably null
R2150:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2177:Pkhd1l1	UTSW	15	44459395	missense	probably benign
R2184:Pkhd1l1	UTSW	15	44499296	missense	possibly damaging	0.89
R2216:Pkhd1l1	UTSW	15	44573895	missense	probably damaging	1.00
R2226:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2227:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2243:Pkhd1l1	UTSW	15	44546927	missense	probably damaging	1.00
R2290:Pkhd1l1	UTSW	15	44528250	missense	probably benign	0.03
R2294:Pkhd1l1	UTSW	15	44479607	missense	probably damaging	0.99
R2346:Pkhd1l1	UTSW	15	44560506	missense	possibly damaging	0.82
R2356:Pkhd1l1	UTSW	15	44533019	missense	probably benign	0.00
R2386:Pkhd1l1	UTSW	15	44528178	missense	probably benign	0.00
R2404:Pkhd1l1	UTSW	15	44550820	missense	probably damaging	1.00
R2504:Pkhd1l1	UTSW	15	44485428	missense	probably damaging	0.97
R2679:Pkhd1l1	UTSW	15	44545386	missense	probably damaging	0.99
R2860:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2861:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2862:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2972:Pkhd1l1	UTSW	15	44547248	missense	possibly damaging	0.65
R3016:Pkhd1l1	UTSW	15	44545370	missense	probably benign	0.02
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3416:Pkhd1l1	UTSW	15	44547364	missense	probably damaging	1.00
R3623:Pkhd1l1	UTSW	15	44526869	missense	probably damaging	1.00
R3687:Pkhd1l1	UTSW	15	44546587	missense	probably benign	0.17
R3755:Pkhd1l1	UTSW	15	44589406	missense	probably damaging	1.00
R3776:Pkhd1l1	UTSW	15	44514975	critical splice donor site	probably null
R3803:Pkhd1l1	UTSW	15	44493135	missense	probably benign	0.25
R3942:Pkhd1l1	UTSW	15	44592026	critical splice donor site	probably null
R4010:Pkhd1l1	UTSW	15	44529100	missense	possibly damaging	0.80
R4049:Pkhd1l1	UTSW	15	44498557	missense	probably damaging	1.00
R4059:Pkhd1l1	UTSW	15	44550760	missense	probably benign	0.01
R4179:Pkhd1l1	UTSW	15	44523649	missense	probably benign	0.45
R4184:Pkhd1l1	UTSW	15	44591906	missense	probably benign	0.00
R4369:Pkhd1l1	UTSW	15	44505553	missense	probably benign	0.00
R4462:Pkhd1l1	UTSW	15	44581804	missense	probably damaging	1.00
R4551:Pkhd1l1	UTSW	15	44550885	missense	probably damaging	1.00
R4618:Pkhd1l1	UTSW	15	44539682	missense	probably damaging	1.00
R4632:Pkhd1l1	UTSW	15	44484400	missense	probably benign	0.07
R4657:Pkhd1l1	UTSW	15	44547347	missense	probably damaging	1.00
R4716:Pkhd1l1	UTSW	15	44556032	missense	probably damaging	1.00
R4788:Pkhd1l1	UTSW	15	44498021	missense	probably damaging	0.99
R4828:Pkhd1l1	UTSW	15	44529405	missense	possibly damaging	0.55
R4858:Pkhd1l1	UTSW	15	44491101	missense	probably damaging	0.99
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4951:Pkhd1l1	UTSW	15	44533891	missense	possibly damaging	0.82
R4963:Pkhd1l1	UTSW	15	44504025	missense	probably benign	0.00
R5023:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R5023:Pkhd1l1	UTSW	15	44582227	missense	probably benign	0.00
R5035:Pkhd1l1	UTSW	15	44568324	missense	probably damaging	1.00
R5049:Pkhd1l1	UTSW	15	44457616	missense	probably benign	0.00
R5065:Pkhd1l1	UTSW	15	44582293	missense	possibly damaging	0.68
R5089:Pkhd1l1	UTSW	15	44591887	missense	probably benign	0.01
R5151:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5153:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5189:Pkhd1l1	UTSW	15	44547148	missense	probably damaging	1.00
R5204:Pkhd1l1	UTSW	15	44547041	missense	possibly damaging	0.51
R5216:Pkhd1l1	UTSW	15	44495647	nonsense	probably null
R5286:Pkhd1l1	UTSW	15	44514972	nonsense	probably null
R5292:Pkhd1l1	UTSW	15	44529566	missense	probably damaging	1.00
R5293:Pkhd1l1	UTSW	15	44535750	missense	probably benign	0.01
R5298:Pkhd1l1	UTSW	15	44504046	missense	probably benign	0.00
R5327:Pkhd1l1	UTSW	15	44546862	missense	probably damaging	1.00
R5346:Pkhd1l1	UTSW	15	44540967	missense	probably damaging	1.00
R5481:Pkhd1l1	UTSW	15	44558646	missense	probably damaging	1.00
R5645:Pkhd1l1	UTSW	15	44532992	missense	probably benign	0.18
R5718:Pkhd1l1	UTSW	15	44545417	missense	probably damaging	1.00
R5809:Pkhd1l1	UTSW	15	44519707	missense	probably benign	0.03
R5816:Pkhd1l1	UTSW	15	44566322	missense	probably benign	0.01
R5854:Pkhd1l1	UTSW	15	44581790	missense	probably damaging	1.00
R5876:Pkhd1l1	UTSW	15	44578588	missense	possibly damaging	0.51
R5909:Pkhd1l1	UTSW	15	44526763	missense	probably damaging	1.00
R5950:Pkhd1l1	UTSW	15	44532965	missense	probably benign	0.00
R5961:Pkhd1l1	UTSW	15	44459463	missense	probably damaging	1.00
R5972:Pkhd1l1	UTSW	15	44545416	missense	probably damaging	1.00
R5975:Pkhd1l1	UTSW	15	44525988	missense	probably damaging	1.00
R5982:Pkhd1l1	UTSW	15	44489504	splice site	probably null
R6066:Pkhd1l1	UTSW	15	44528129	missense	probably damaging	0.99
R6122:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6248:Pkhd1l1	UTSW	15	44529559	missense	probably benign
R6294:Pkhd1l1	UTSW	15	44570028	missense	probably damaging	1.00
R6301:Pkhd1l1	UTSW	15	44589525	missense	probably damaging	0.99
R6526:Pkhd1l1	UTSW	15	44498089	critical splice donor site	probably null
R6707:Pkhd1l1	UTSW	15	44529143	missense	probably benign
R6736:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6753:Pkhd1l1	UTSW	15	44589663	missense	probably benign	0.45
R6815:Pkhd1l1	UTSW	15	44562655	missense	probably damaging	1.00
R6874:Pkhd1l1	UTSW	15	44589527	missense	probably benign	0.06
R6942:Pkhd1l1	UTSW	15	44522629	missense	probably damaging	1.00
R6970:Pkhd1l1	UTSW	15	44511674	missense	possibly damaging	0.61
R6982:Pkhd1l1	UTSW	15	44566268	missense	probably damaging	0.97
R7103:Pkhd1l1	UTSW	15	44573631	missense	probably benign	0.02
R7116:Pkhd1l1	UTSW	15	44557976	missense	probably benign	0.00
R7135:Pkhd1l1	UTSW	15	44584978	critical splice donor site	probably null
R7143:Pkhd1l1	UTSW	15	44573637	missense	possibly damaging	0.93
R7177:Pkhd1l1	UTSW	15	44467404	missense	probably damaging	1.00
R7194:Pkhd1l1	UTSW	15	44529116	missense	probably damaging	1.00
R7204:Pkhd1l1	UTSW	15	44523553	missense	possibly damaging	0.90
R7215:Pkhd1l1	UTSW	15	44528163	missense	possibly damaging	0.78
R7218:Pkhd1l1	UTSW	15	44522695	missense	possibly damaging	0.49
R7225:Pkhd1l1	UTSW	15	44546941	missense	probably damaging	1.00
R7283:Pkhd1l1	UTSW	15	44503280	missense	probably benign	0.10
R7292:Pkhd1l1	UTSW	15	44498590	missense	probably benign
R7304:Pkhd1l1	UTSW	15	44498482	missense	possibly damaging	0.94
R7349:Pkhd1l1	UTSW	15	44514954	missense	probably damaging	1.00
R7359:Pkhd1l1	UTSW	15	44589486	missense	probably damaging	1.00
R7407:Pkhd1l1	UTSW	15	44595011	missense	possibly damaging	0.75
R7475:Pkhd1l1	UTSW	15	44505185	nonsense	probably null
R7481:Pkhd1l1	UTSW	15	44512911	missense	probably benign
R7554:Pkhd1l1	UTSW	15	44495470	missense	probably damaging	1.00
R7555:Pkhd1l1	UTSW	15	44550761	missense	possibly damaging	0.51
R7562:Pkhd1l1	UTSW	15	44514930	missense	possibly damaging	0.68
R7583:Pkhd1l1	UTSW	15	44568364	critical splice donor site	probably null
R7595:Pkhd1l1	UTSW	15	44495521	missense	probably damaging	1.00
R7749:Pkhd1l1	UTSW	15	44527737	missense	probably benign	0.00
R7761:Pkhd1l1	UTSW	15	44529884	missense	probably benign	0.00
R7774:Pkhd1l1	UTSW	15	44540907	missense	probably benign	0.03
R7785:Pkhd1l1	UTSW	15	44543569	missense	probably damaging	1.00
R7790:Pkhd1l1	UTSW	15	44578581	missense	probably damaging	1.00
R7804:Pkhd1l1	UTSW	15	44597138	nonsense	probably null
R7864:Pkhd1l1	UTSW	15	44526053	critical splice donor site	probably null
R7883:Pkhd1l1	UTSW	15	44529126	missense	probably damaging	1.00
R8031:Pkhd1l1	UTSW	15	44512834	missense	probably damaging	1.00
R8128:Pkhd1l1	UTSW	15	44498053	missense	possibly damaging	0.94
R8142:Pkhd1l1	UTSW	15	44514931	missense	probably benign	0.00
R8150:Pkhd1l1	UTSW	15	44546659	missense	possibly damaging	0.68
R8209:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8212:Pkhd1l1	UTSW	15	44499300	missense	probably benign	0.12
R8226:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8248:Pkhd1l1	UTSW	15	44543546	missense	probably damaging	0.99
R8299:Pkhd1l1	UTSW	15	44581934	missense	probably benign	0.26
R8425:Pkhd1l1	UTSW	15	44574515	missense	probably benign	0.01
RF006:Pkhd1l1	UTSW	15	44503238	missense	probably benign	0.03
RF006:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF008:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF012:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF019:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF030:Pkhd1l1	UTSW	15	44558502	critical splice acceptor site	probably benign
RF033:Pkhd1l1	UTSW	15	44558506	critical splice acceptor site	probably benign
RF038:Pkhd1l1	UTSW	15	44558503	critical splice acceptor site	probably benign
RF046:Pkhd1l1	UTSW	15	44558495	critical splice acceptor site	probably benign
X0027:Pkhd1l1	UTSW	15	44591966	missense	probably damaging	0.99
Z1177:Pkhd1l1	UTSW	15	44573576	missense	probably damaging	0.97
Z1177:Pkhd1l1	UTSW	15	44578578	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTACTGGGACTTATCACTTAGTGG -3'
(R):5'- ATCTTCATGCACAGGGAGGG -3'

Sequencing Primer
(F):5'- CTACATTAATTGGTTAGATGCAAGCG -3'
(R):5'- ACCACTAGTAAAGATCTTTCAAAGC -3'

Posted On

2019-11-26