Incidental Mutation 'R7754:Sept3'
ID597468
Institutional Source Beutler Lab
Gene Symbol Sept3
Ensembl Gene ENSMUSG00000022456
Gene Nameseptin 3
SynonymsB530002E20Rik, Sep3, 3110018K01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82274893-82294574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82290773 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 305 (N305S)
Ref Sequence ENSEMBL: ENSMUSP00000112124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023095] [ENSMUST00000116423] [ENSMUST00000230365] [ENSMUST00000230418] [ENSMUST00000230507]
Predicted Effect probably benign
Transcript: ENSMUST00000023095
AA Change: N305S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000023095
Gene: ENSMUSG00000022456
AA Change: N305S

DomainStartEndE-ValueType
Pfam:DUF258 27 143 9.1e-9 PFAM
Pfam:Septin 45 322 8.9e-117 PFAM
Pfam:AIG1 49 145 2.6e-7 PFAM
Pfam:MMR_HSR1 50 220 2.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116423
AA Change: N305S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112124
Gene: ENSMUSG00000022456
AA Change: N305S

DomainStartEndE-ValueType
Pfam:Septin 45 322 1.2e-116 PFAM
Pfam:MMR_HSR1 50 195 3.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230365
AA Change: N305S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000230418
Predicted Effect probably benign
Transcript: ENSMUST00000230507
AA Change: N161S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the septin family of GTPases. Members of this family are required for cytokinesis. Expression is upregulated by retinoic acid in a human teratocarcinoma cell line. The specific function of this gene has not been determined. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Sept3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Sept3 APN 15 82279613 unclassified probably benign
IGL01979:Sept3 APN 15 82284392 missense probably damaging 0.99
IGL03118:Sept3 APN 15 82284514 splice site probably null
R0478:Sept3 UTSW 15 82290806 missense probably damaging 1.00
R0556:Sept3 UTSW 15 82283765 unclassified probably benign
R3804:Sept3 UTSW 15 82286429 splice site probably benign
R3876:Sept3 UTSW 15 82285801 missense probably damaging 1.00
R4589:Sept3 UTSW 15 82285891 missense probably damaging 0.99
R4744:Sept3 UTSW 15 82290457 critical splice donor site probably null
R5954:Sept3 UTSW 15 82290427 missense probably damaging 1.00
R6434:Sept3 UTSW 15 82279603 missense possibly damaging 0.92
R7257:Sept3 UTSW 15 82289213 missense probably damaging 0.99
R7475:Sept3 UTSW 15 82286456 missense probably benign 0.00
R7641:Sept3 UTSW 15 82290782 missense probably damaging 1.00
R7895:Sept3 UTSW 15 82285819 missense probably benign 0.00
R7978:Sept3 UTSW 15 82285819 missense probably benign 0.00
RF020:Sept3 UTSW 15 82284461 missense probably damaging 1.00
X0065:Sept3 UTSW 15 82279504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGACATTGGTCCTCAAGGGTG -3'
(R):5'- TGCACAAATACCAGACAGGC -3'

Sequencing Primer
(F):5'- TCCTCAAGGGTGGGTCC -3'
(R):5'- AGACAGGCCTGGGGGAC -3'
Posted On2019-11-26