Incidental Mutation 'R7754:Ppp6r2'
ID597469
Institutional Source Beutler Lab
Gene Symbol Ppp6r2
Ensembl Gene ENSMUSG00000036561
Gene Nameprotein phosphatase 6, regulatory subunit 2
SynonymsPp6r2, Saps2, 1110033O10Rik, 8430411H09Rik, B230107H12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89211553-89287010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89256701 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 89 (V89A)
Ref Sequence ENSEMBL: ENSMUSP00000086167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088788] [ENSMUST00000226221] [ENSMUST00000227951] [ENSMUST00000228284]
Predicted Effect probably benign
Transcript: ENSMUST00000088788
AA Change: V89A

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086167
Gene: ENSMUSG00000036561
AA Change: V89A

DomainStartEndE-ValueType
Pfam:SAPS 128 365 1.7e-73 PFAM
Pfam:SAPS 361 534 2.4e-47 PFAM
low complexity region 606 618 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 867 900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226221
Predicted Effect probably benign
Transcript: ENSMUST00000227951
Predicted Effect probably benign
Transcript: ENSMUST00000228284
AA Change: V89A

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS2, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS2 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Nlgn1 C T 3: 25,434,303 V623I probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,825,505 probably null Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Ppp6r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ppp6r2 APN 15 89285813 missense probably benign 0.44
IGL00480:Ppp6r2 APN 15 89265249 splice site probably benign
IGL01061:Ppp6r2 APN 15 89286015 splice site probably benign
IGL01116:Ppp6r2 APN 15 89281989 missense probably damaging 1.00
IGL01317:Ppp6r2 APN 15 89285928 missense possibly damaging 0.62
IGL01947:Ppp6r2 APN 15 89278726 missense probably damaging 1.00
IGL01969:Ppp6r2 APN 15 89275510 missense probably damaging 0.99
IGL01999:Ppp6r2 APN 15 89269952 missense probably benign 0.09
IGL02634:Ppp6r2 APN 15 89275477 nonsense probably null
IGL02697:Ppp6r2 APN 15 89256755 missense probably benign 0.38
IGL02964:Ppp6r2 APN 15 89259175 missense probably damaging 1.00
IGL03107:Ppp6r2 APN 15 89268545 missense probably damaging 0.98
IGL03195:Ppp6r2 APN 15 89268555 missense possibly damaging 0.50
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0183:Ppp6r2 UTSW 15 89285787 missense probably damaging 0.99
R0745:Ppp6r2 UTSW 15 89265242 critical splice donor site probably null
R0835:Ppp6r2 UTSW 15 89268582 missense possibly damaging 0.90
R0959:Ppp6r2 UTSW 15 89274176 missense possibly damaging 0.81
R1661:Ppp6r2 UTSW 15 89253051 missense possibly damaging 0.96
R1867:Ppp6r2 UTSW 15 89281938 missense probably benign 0.01
R2081:Ppp6r2 UTSW 15 89282129 missense probably benign 0.01
R2102:Ppp6r2 UTSW 15 89278746 missense probably damaging 1.00
R2291:Ppp6r2 UTSW 15 89275487 missense probably damaging 1.00
R2900:Ppp6r2 UTSW 15 89281995 missense probably damaging 1.00
R3805:Ppp6r2 UTSW 15 89265639 missense probably benign 0.30
R3965:Ppp6r2 UTSW 15 89259114 missense probably benign 0.20
R4374:Ppp6r2 UTSW 15 89265158 missense probably damaging 1.00
R4901:Ppp6r2 UTSW 15 89259069 missense possibly damaging 0.88
R5055:Ppp6r2 UTSW 15 89282949 missense probably benign 0.01
R5668:Ppp6r2 UTSW 15 89280399 missense probably damaging 1.00
R5739:Ppp6r2 UTSW 15 89259073 missense probably benign 0.02
R6026:Ppp6r2 UTSW 15 89282910 missense probably benign 0.02
R6058:Ppp6r2 UTSW 15 89253252 critical splice donor site probably null
R6488:Ppp6r2 UTSW 15 89268538 missense probably benign 0.12
R6631:Ppp6r2 UTSW 15 89253255 splice site probably null
R6633:Ppp6r2 UTSW 15 89253255 splice site probably null
R6744:Ppp6r2 UTSW 15 89256661 critical splice acceptor site probably null
R7149:Ppp6r2 UTSW 15 89262396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTTGTCTCGTGCCATG -3'
(R):5'- AGGAGCCTGGTAATAGTTGCAC -3'

Sequencing Primer
(F):5'- TCTCATGGATGCCTGGAAAC -3'
(R):5'- GAGCCTGGTAATAGTTGCACAGTATC -3'
Posted On2019-11-26