Incidental Mutation 'R7755:Nsl1'
ID597480
Institutional Source Beutler Lab
Gene Symbol Nsl1
Ensembl Gene ENSMUSG00000062510
Gene NameNSL1, MIS12 kinetochore complex component
SynonymsLOC381318, 4833432M17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R7755 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location191063012-191086474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 191063183 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 49 (V49M)
Ref Sequence ENSEMBL: ENSMUSP00000077380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027945] [ENSMUST00000076952] [ENSMUST00000078259] [ENSMUST00000085633] [ENSMUST00000110891] [ENSMUST00000110893] [ENSMUST00000139340]
Predicted Effect probably benign
Transcript: ENSMUST00000027945
SMART Domains Protein: ENSMUSP00000027945
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 263 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076952
AA Change: V49M

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076220
Gene: ENSMUSG00000062510
AA Change: V49M

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 67 170 1.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078259
AA Change: V49M

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077380
Gene: ENSMUSG00000062510
AA Change: V49M

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 82 197 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085633
SMART Domains Protein: ENSMUSP00000082773
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 170 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110891
SMART Domains Protein: ENSMUSP00000106516
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 231 2.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110893
SMART Domains Protein: ENSMUSP00000106518
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 264 1.8e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139340
AA Change: V49M

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115289
Gene: ENSMUSG00000062510
AA Change: V49M

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 67 171 7e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
4930402F06Rik T C 2: 35,376,337 Y107C probably damaging Het
Aff4 T C 11: 53,398,379 S452P probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Begain A G 12: 109,052,876 L215P probably benign Het
Carf T A 1: 60,148,055 S606T probably benign Het
Cngb3 A T 4: 19,461,684 T522S probably benign Het
Ctsll3 A T 13: 60,800,405 F153I probably damaging Het
Cubn G A 2: 13,280,078 T3509I probably benign Het
Dmrta1 T C 4: 89,691,933 S377P probably benign Het
Dnmbp G A 19: 43,850,086 A659V probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 T C 9: 7,015,490 D3598G probably benign Het
Fam35a T C 14: 34,248,890 K627E probably damaging Het
Flot2 T C 11: 78,049,513 F29L probably benign Het
Hectd1 A T 12: 51,802,220 I367K possibly damaging Het
Ikbkap T C 4: 56,774,552 N779S possibly damaging Het
Ivl T A 3: 92,572,010 K249N probably damaging Het
Kdelc1 T C 1: 44,118,573 probably benign Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Mbd4 T A 6: 115,844,585 I490F probably damaging Het
Mlip T C 9: 77,229,556 T690A probably benign Het
Mmp1a T A 9: 7,467,004 D227E possibly damaging Het
Mrgprf T C 7: 145,308,643 L314P probably damaging Het
Ndufb9 T G 15: 58,936,406 Y80* probably null Het
Neto2 C T 8: 85,669,656 R155H probably damaging Het
Npat T A 9: 53,559,170 N365K possibly damaging Het
Nudt21 T A 8: 94,022,865 Y191F probably benign Het
Olfr225 A G 11: 59,613,641 R226G probably damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Pcdh18 T C 3: 49,754,829 Y679C possibly damaging Het
Pkd1l3 A G 8: 109,630,166 D741G possibly damaging Het
Pkhd1 T C 1: 20,547,493 D956G probably damaging Het
Pparg C T 6: 115,463,106 P214S probably damaging Het
Ppargc1a T A 5: 51,473,541 Y582F unknown Het
Prdm9 C T 17: 15,544,964 C518Y probably damaging Het
Rangrf T A 11: 68,973,714 E2V probably damaging Het
Rpl19 T C 11: 98,028,367 I45T probably benign Het
Rtn4rl2 T C 2: 84,872,463 D255G possibly damaging Het
Sirt3 T C 7: 140,878,050 D62G Het
Slc22a30 T C 19: 8,336,769 T518A probably damaging Het
Slc40a1 T C 1: 45,911,306 T329A probably damaging Het
Slc6a17 C T 3: 107,474,355 G470D probably damaging Het
Syne2 A T 12: 75,997,407 I3923L probably benign Het
Tiam2 C T 17: 3,421,316 S411L probably benign Het
Ticam1 A G 17: 56,270,182 C638R unknown Het
Tnrc6c A G 11: 117,758,086 T1528A probably benign Het
Ufl1 A G 4: 25,262,274 I404T probably benign Het
Usp43 A T 11: 67,891,468 S375T possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Vmn2r91 A T 17: 18,110,049 I532F possibly damaging Het
Vmn2r95 T C 17: 18,424,105 M1T probably null Het
Xirp2 T C 2: 67,515,182 V2589A probably benign Het
Zfp128 C T 7: 12,890,313 Q203* probably null Het
Other mutations in Nsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Nsl1 APN 1 191071201 missense probably benign 0.06
IGL03398:Nsl1 APN 1 191082164 splice site probably benign
IGL02988:Nsl1 UTSW 1 191063103 nonsense probably null
R0054:Nsl1 UTSW 1 191082184 missense probably damaging 1.00
R0054:Nsl1 UTSW 1 191082184 missense probably damaging 1.00
R0284:Nsl1 UTSW 1 191065230 missense probably damaging 1.00
R0482:Nsl1 UTSW 1 191063040 start codon destroyed probably null 0.83
R1776:Nsl1 UTSW 1 191063188 missense probably benign
R5187:Nsl1 UTSW 1 191075190 missense probably benign 0.01
R5470:Nsl1 UTSW 1 191080540 missense probably benign 0.24
R5838:Nsl1 UTSW 1 191070113 missense probably benign 0.02
R6133:Nsl1 UTSW 1 191071206 missense probably damaging 0.99
R6636:Nsl1 UTSW 1 191075127 missense probably benign 0.00
R6817:Nsl1 UTSW 1 191063274 critical splice donor site probably null
R8506:Nsl1 UTSW 1 191076635 missense unknown
Z1177:Nsl1 UTSW 1 191063231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGCCTTAGTTTAAACCG -3'
(R):5'- GCCCTGTATGTTCCTGACAG -3'

Sequencing Primer
(F):5'- CCGCCTTAGTTTAAACCGGGAAG -3'
(R):5'- AGGCGGCACTAGCATCTAGTTG -3'
Posted On2019-11-26