Incidental Mutation 'R7755:Ivl'
ID597486
Institutional Source Beutler Lab
Gene Symbol Ivl
Ensembl Gene ENSMUSG00000049128
Gene Nameinvolucrin
Synonyms1110019C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7755 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location92570902-92573735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92572010 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 249 (K249N)
Ref Sequence ENSEMBL: ENSMUSP00000059780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053107]
Predicted Effect probably damaging
Transcript: ENSMUST00000053107
AA Change: K249N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059780
Gene: ENSMUSG00000049128
AA Change: K249N

DomainStartEndE-ValueType
Pfam:Involucrin_N 1 67 2e-32 PFAM
Pfam:Involucrin2 94 134 1.3e-7 PFAM
Pfam:Involucrin2 173 211 1.9e-13 PFAM
Pfam:Involucrin2 210 249 4.1e-12 PFAM
Pfam:Involucrin2 239 278 2.9e-13 PFAM
Pfam:Involucrin2 268 306 4.1e-10 PFAM
Pfam:Involucrin2 311 351 4.6e-14 PFAM
Pfam:Involucrin2 343 376 1.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
4930402F06Rik T C 2: 35,376,337 Y107C probably damaging Het
Aff4 T C 11: 53,398,379 S452P probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Begain A G 12: 109,052,876 L215P probably benign Het
Carf T A 1: 60,148,055 S606T probably benign Het
Cngb3 A T 4: 19,461,684 T522S probably benign Het
Ctsll3 A T 13: 60,800,405 F153I probably damaging Het
Cubn G A 2: 13,280,078 T3509I probably benign Het
Dmrta1 T C 4: 89,691,933 S377P probably benign Het
Dnmbp G A 19: 43,850,086 A659V probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 T C 9: 7,015,490 D3598G probably benign Het
Fam35a T C 14: 34,248,890 K627E probably damaging Het
Flot2 T C 11: 78,049,513 F29L probably benign Het
Hectd1 A T 12: 51,802,220 I367K possibly damaging Het
Ikbkap T C 4: 56,774,552 N779S possibly damaging Het
Kdelc1 T C 1: 44,118,573 probably benign Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Mbd4 T A 6: 115,844,585 I490F probably damaging Het
Mlip T C 9: 77,229,556 T690A probably benign Het
Mmp1a T A 9: 7,467,004 D227E possibly damaging Het
Mrgprf T C 7: 145,308,643 L314P probably damaging Het
Ndufb9 T G 15: 58,936,406 Y80* probably null Het
Neto2 C T 8: 85,669,656 R155H probably damaging Het
Npat T A 9: 53,559,170 N365K possibly damaging Het
Nsl1 G A 1: 191,063,183 V49M probably benign Het
Nudt21 T A 8: 94,022,865 Y191F probably benign Het
Olfr225 A G 11: 59,613,641 R226G probably damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Pcdh18 T C 3: 49,754,829 Y679C possibly damaging Het
Pkd1l3 A G 8: 109,630,166 D741G possibly damaging Het
Pkhd1 T C 1: 20,547,493 D956G probably damaging Het
Pparg C T 6: 115,463,106 P214S probably damaging Het
Ppargc1a T A 5: 51,473,541 Y582F unknown Het
Prdm9 C T 17: 15,544,964 C518Y probably damaging Het
Rangrf T A 11: 68,973,714 E2V probably damaging Het
Rpl19 T C 11: 98,028,367 I45T probably benign Het
Rtn4rl2 T C 2: 84,872,463 D255G possibly damaging Het
Sirt3 T C 7: 140,878,050 D62G Het
Slc22a30 T C 19: 8,336,769 T518A probably damaging Het
Slc40a1 T C 1: 45,911,306 T329A probably damaging Het
Slc6a17 C T 3: 107,474,355 G470D probably damaging Het
Syne2 A T 12: 75,997,407 I3923L probably benign Het
Tiam2 C T 17: 3,421,316 S411L probably benign Het
Ticam1 A G 17: 56,270,182 C638R unknown Het
Tnrc6c A G 11: 117,758,086 T1528A probably benign Het
Ufl1 A G 4: 25,262,274 I404T probably benign Het
Usp43 A T 11: 67,891,468 S375T possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Vmn2r91 A T 17: 18,110,049 I532F possibly damaging Het
Vmn2r95 T C 17: 18,424,105 M1T probably null Het
Xirp2 T C 2: 67,515,182 V2589A probably benign Het
Zfp128 C T 7: 12,890,313 Q203* probably null Het
Other mutations in Ivl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Ivl APN 3 92572512 missense possibly damaging 0.68
IGL01656:Ivl APN 3 92571655 nonsense probably null
IGL01820:Ivl APN 3 92571633 missense possibly damaging 0.95
IGL03012:Ivl APN 3 92572426 missense probably benign 0.01
PIT4142001:Ivl UTSW 3 92572301 small deletion probably benign
PIT4151001:Ivl UTSW 3 92572301 small deletion probably benign
PIT4458001:Ivl UTSW 3 92572301 small insertion probably benign
R0256:Ivl UTSW 3 92571843 missense probably damaging 1.00
R0276:Ivl UTSW 3 92571514 missense unknown
R1800:Ivl UTSW 3 92572584 missense unknown
R1940:Ivl UTSW 3 92572749 missense probably benign 0.00
R1950:Ivl UTSW 3 92572113 missense possibly damaging 0.85
R2887:Ivl UTSW 3 92571392 missense unknown
R4457:Ivl UTSW 3 92572366 missense probably benign 0.03
R4561:Ivl UTSW 3 92571955 small insertion probably benign
R4562:Ivl UTSW 3 92571955 small insertion probably benign
R4698:Ivl UTSW 3 92571391 missense unknown
R4708:Ivl UTSW 3 92571750 missense probably damaging 1.00
R4885:Ivl UTSW 3 92572411 missense probably benign 0.03
R6354:Ivl UTSW 3 92571910 small deletion probably benign
R6355:Ivl UTSW 3 92571910 small deletion probably benign
R6356:Ivl UTSW 3 92571910 small deletion probably benign
R6582:Ivl UTSW 3 92571910 small deletion probably benign
R6723:Ivl UTSW 3 92571387 missense unknown
R7091:Ivl UTSW 3 92572242 missense possibly damaging 0.85
R7146:Ivl UTSW 3 92572231 missense probably damaging 0.97
R7841:Ivl UTSW 3 92572392 missense possibly damaging 0.52
R8048:Ivl UTSW 3 92571924 missense probably damaging 1.00
R8171:Ivl UTSW 3 92571778 missense probably damaging 1.00
R8363:Ivl UTSW 3 92572218 missense possibly damaging 0.71
R8434:Ivl UTSW 3 92572636 missense probably benign 0.01
R8504:Ivl UTSW 3 92572771 start gained probably benign
RF013:Ivl UTSW 3 92572343 small deletion probably benign
RF031:Ivl UTSW 3 92572318 frame shift probably null
RF036:Ivl UTSW 3 92572341 frame shift probably null
RF038:Ivl UTSW 3 92572300 small deletion probably benign
RF055:Ivl UTSW 3 92572300 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TACTGCTGCTTTCTCAGGTACAG -3'
(R):5'- CAGAACTGCATCTGGGTCAG -3'

Sequencing Primer
(F):5'- CTCAGGTACAGTTCTGGCTTATGAAG -3'
(R):5'- TCTGGGTCAGCAGCAGAAAACTC -3'
Posted On2019-11-26