Incidental Mutation 'R7755:Ufl1'
ID597489
Institutional Source Beutler Lab
Gene Symbol Ufl1
Ensembl Gene ENSMUSG00000040359
Gene NameUFM1 specific ligase 1
Synonyms1810074P20Rik, Maxer, Rcad
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R7755 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location25248600-25281821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25262274 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 404 (I404T)
Ref Sequence ENSEMBL: ENSMUSP00000100059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038705] [ENSMUST00000102994]
Predicted Effect probably benign
Transcript: ENSMUST00000038705
AA Change: I324T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042118
Gene: ENSMUSG00000040359
AA Change: I324T

DomainStartEndE-ValueType
Pfam:DUF2042 2 205 1.5e-70 PFAM
low complexity region 334 344 N/A INTRINSIC
low complexity region 348 358 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102994
AA Change: I404T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100059
Gene: ENSMUSG00000040359
AA Change: I404T

DomainStartEndE-ValueType
Pfam:DUF2042 7 284 4.8e-117 PFAM
low complexity region 414 424 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 444 454 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogensis, anemia and decreased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
4930402F06Rik T C 2: 35,376,337 Y107C probably damaging Het
Aff4 T C 11: 53,398,379 S452P probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Begain A G 12: 109,052,876 L215P probably benign Het
Carf T A 1: 60,148,055 S606T probably benign Het
Cngb3 A T 4: 19,461,684 T522S probably benign Het
Ctsll3 A T 13: 60,800,405 F153I probably damaging Het
Cubn G A 2: 13,280,078 T3509I probably benign Het
Dmrta1 T C 4: 89,691,933 S377P probably benign Het
Dnmbp G A 19: 43,850,086 A659V probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 T C 9: 7,015,490 D3598G probably benign Het
Fam35a T C 14: 34,248,890 K627E probably damaging Het
Flot2 T C 11: 78,049,513 F29L probably benign Het
Hectd1 A T 12: 51,802,220 I367K possibly damaging Het
Ikbkap T C 4: 56,774,552 N779S possibly damaging Het
Ivl T A 3: 92,572,010 K249N probably damaging Het
Kdelc1 T C 1: 44,118,573 probably benign Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Mbd4 T A 6: 115,844,585 I490F probably damaging Het
Mlip T C 9: 77,229,556 T690A probably benign Het
Mmp1a T A 9: 7,467,004 D227E possibly damaging Het
Mrgprf T C 7: 145,308,643 L314P probably damaging Het
Ndufb9 T G 15: 58,936,406 Y80* probably null Het
Neto2 C T 8: 85,669,656 R155H probably damaging Het
Npat T A 9: 53,559,170 N365K possibly damaging Het
Nsl1 G A 1: 191,063,183 V49M probably benign Het
Nudt21 T A 8: 94,022,865 Y191F probably benign Het
Olfr225 A G 11: 59,613,641 R226G probably damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Pcdh18 T C 3: 49,754,829 Y679C possibly damaging Het
Pkd1l3 A G 8: 109,630,166 D741G possibly damaging Het
Pkhd1 T C 1: 20,547,493 D956G probably damaging Het
Pparg C T 6: 115,463,106 P214S probably damaging Het
Ppargc1a T A 5: 51,473,541 Y582F unknown Het
Prdm9 C T 17: 15,544,964 C518Y probably damaging Het
Rangrf T A 11: 68,973,714 E2V probably damaging Het
Rpl19 T C 11: 98,028,367 I45T probably benign Het
Rtn4rl2 T C 2: 84,872,463 D255G possibly damaging Het
Sirt3 T C 7: 140,878,050 D62G Het
Slc22a30 T C 19: 8,336,769 T518A probably damaging Het
Slc40a1 T C 1: 45,911,306 T329A probably damaging Het
Slc6a17 C T 3: 107,474,355 G470D probably damaging Het
Syne2 A T 12: 75,997,407 I3923L probably benign Het
Tiam2 C T 17: 3,421,316 S411L probably benign Het
Ticam1 A G 17: 56,270,182 C638R unknown Het
Tnrc6c A G 11: 117,758,086 T1528A probably benign Het
Usp43 A T 11: 67,891,468 S375T possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Vmn2r91 A T 17: 18,110,049 I532F possibly damaging Het
Vmn2r95 T C 17: 18,424,105 M1T probably null Het
Xirp2 T C 2: 67,515,182 V2589A probably benign Het
Zfp128 C T 7: 12,890,313 Q203* probably null Het
Other mutations in Ufl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ufl1 APN 4 25280631 missense possibly damaging 0.67
IGL00899:Ufl1 APN 4 25262238 missense probably damaging 1.00
IGL00928:Ufl1 APN 4 25267790 missense probably damaging 1.00
IGL00949:Ufl1 APN 4 25275822 missense probably damaging 0.99
IGL02179:Ufl1 APN 4 25254896 missense probably damaging 0.99
IGL02228:Ufl1 APN 4 25281686 missense probably benign
IGL02237:Ufl1 APN 4 25269082 missense probably benign 0.01
IGL02294:Ufl1 APN 4 25259281 nonsense probably null
IGL02331:Ufl1 APN 4 25251971 missense probably damaging 1.00
IGL02374:Ufl1 APN 4 25259237 missense probably benign 0.01
IGL02541:Ufl1 APN 4 25250534 missense possibly damaging 0.56
IGL03053:Ufl1 APN 4 25275833 missense probably damaging 0.99
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0172:Ufl1 UTSW 4 25280685 missense probably benign 0.32
R2069:Ufl1 UTSW 4 25269036 missense possibly damaging 0.75
R4320:Ufl1 UTSW 4 25278601 splice site probably null
R4467:Ufl1 UTSW 4 25254806 missense probably damaging 1.00
R4993:Ufl1 UTSW 4 25267832 missense possibly damaging 0.70
R5049:Ufl1 UTSW 4 25254773 missense probably benign 0.17
R5071:Ufl1 UTSW 4 25254780 missense probably benign
R5072:Ufl1 UTSW 4 25254780 missense probably benign
R5073:Ufl1 UTSW 4 25254780 missense probably benign
R5099:Ufl1 UTSW 4 25275914 missense probably damaging 0.99
R5108:Ufl1 UTSW 4 25269026 critical splice donor site probably null
R5127:Ufl1 UTSW 4 25256010 missense probably benign 0.05
R5262:Ufl1 UTSW 4 25251294 intron probably benign
R5409:Ufl1 UTSW 4 25280706 missense probably damaging 1.00
R5942:Ufl1 UTSW 4 25250619 missense probably benign
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6107:Ufl1 UTSW 4 25251999 missense possibly damaging 0.88
R6157:Ufl1 UTSW 4 25279350 missense possibly damaging 0.83
R6296:Ufl1 UTSW 4 25270572 missense probably benign
R6360:Ufl1 UTSW 4 25265476 missense probably benign
R6514:Ufl1 UTSW 4 25262238 missense probably damaging 1.00
R6754:Ufl1 UTSW 4 25267796 nonsense probably null
R6755:Ufl1 UTSW 4 25262316 missense probably damaging 0.96
R7196:Ufl1 UTSW 4 25250669 missense probably benign 0.05
R7247:Ufl1 UTSW 4 25254637 missense probably damaging 1.00
R7287:Ufl1 UTSW 4 25254852 missense probably benign 0.04
R8156:Ufl1 UTSW 4 25269057 missense probably damaging 1.00
R8235:Ufl1 UTSW 4 25278656 missense probably benign 0.31
R8247:Ufl1 UTSW 4 25250606 missense probably benign
RF037:Ufl1 UTSW 4 25280628 missense possibly damaging 0.67
RF039:Ufl1 UTSW 4 25280628 missense possibly damaging 0.67
V7732:Ufl1 UTSW 4 25251368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTTTATCTTCAGAAGAGGGGC -3'
(R):5'- AGCCTCAGAGCAGCAGTCATAG -3'

Sequencing Primer
(F):5'- ATCTTCAGAAGAGGGGCTATCTGC -3'
(R):5'- CAGAGCAGCAGTCATAGATTTTATC -3'
Posted On2019-11-26