Incidental Mutation 'R7755:Dmrta1'
ID597492
Institutional Source Beutler Lab
Gene Symbol Dmrta1
Ensembl Gene ENSMUSG00000043753
Gene Namedoublesex and mab-3 related transcription factor like family A1
SynonymsDmrt4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7755 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location89679436-89694772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89691933 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 377 (S377P)
Ref Sequence ENSEMBL: ENSMUSP00000057488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052478]
Predicted Effect probably benign
Transcript: ENSMUST00000052478
AA Change: S377P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057488
Gene: ENSMUSG00000043753
AA Change: S377P

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DM 82 135 2.31e-30 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:DMA 314 350 3.3e-21 PFAM
low complexity region 393 404 N/A INTRINSIC
Meta Mutation Damage Score 0.0989 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile; however, females exhibit polyovular ovarian follicles while 25% of males display abnormal copulatory behavior toward other males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
4930402F06Rik T C 2: 35,376,337 Y107C probably damaging Het
Aff4 T C 11: 53,398,379 S452P probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Begain A G 12: 109,052,876 L215P probably benign Het
Carf T A 1: 60,148,055 S606T probably benign Het
Cngb3 A T 4: 19,461,684 T522S probably benign Het
Ctsll3 A T 13: 60,800,405 F153I probably damaging Het
Cubn G A 2: 13,280,078 T3509I probably benign Het
Dnmbp G A 19: 43,850,086 A659V probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 T C 9: 7,015,490 D3598G probably benign Het
Fam35a T C 14: 34,248,890 K627E probably damaging Het
Flot2 T C 11: 78,049,513 F29L probably benign Het
Hectd1 A T 12: 51,802,220 I367K possibly damaging Het
Ikbkap T C 4: 56,774,552 N779S possibly damaging Het
Ivl T A 3: 92,572,010 K249N probably damaging Het
Kdelc1 T C 1: 44,118,573 probably benign Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Mbd4 T A 6: 115,844,585 I490F probably damaging Het
Mlip T C 9: 77,229,556 T690A probably benign Het
Mmp1a T A 9: 7,467,004 D227E possibly damaging Het
Mrgprf T C 7: 145,308,643 L314P probably damaging Het
Ndufb9 T G 15: 58,936,406 Y80* probably null Het
Neto2 C T 8: 85,669,656 R155H probably damaging Het
Npat T A 9: 53,559,170 N365K possibly damaging Het
Nsl1 G A 1: 191,063,183 V49M probably benign Het
Nudt21 T A 8: 94,022,865 Y191F probably benign Het
Olfr225 A G 11: 59,613,641 R226G probably damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Pcdh18 T C 3: 49,754,829 Y679C possibly damaging Het
Pkd1l3 A G 8: 109,630,166 D741G possibly damaging Het
Pkhd1 T C 1: 20,547,493 D956G probably damaging Het
Pparg C T 6: 115,463,106 P214S probably damaging Het
Ppargc1a T A 5: 51,473,541 Y582F unknown Het
Prdm9 C T 17: 15,544,964 C518Y probably damaging Het
Rangrf T A 11: 68,973,714 E2V probably damaging Het
Rpl19 T C 11: 98,028,367 I45T probably benign Het
Rtn4rl2 T C 2: 84,872,463 D255G possibly damaging Het
Sirt3 T C 7: 140,878,050 D62G Het
Slc22a30 T C 19: 8,336,769 T518A probably damaging Het
Slc40a1 T C 1: 45,911,306 T329A probably damaging Het
Slc6a17 C T 3: 107,474,355 G470D probably damaging Het
Syne2 A T 12: 75,997,407 I3923L probably benign Het
Tiam2 C T 17: 3,421,316 S411L probably benign Het
Ticam1 A G 17: 56,270,182 C638R unknown Het
Tnrc6c A G 11: 117,758,086 T1528A probably benign Het
Ufl1 A G 4: 25,262,274 I404T probably benign Het
Usp43 A T 11: 67,891,468 S375T possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Vmn2r91 A T 17: 18,110,049 I532F possibly damaging Het
Vmn2r95 T C 17: 18,424,105 M1T probably null Het
Xirp2 T C 2: 67,515,182 V2589A probably benign Het
Zfp128 C T 7: 12,890,313 Q203* probably null Het
Other mutations in Dmrta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02154:Dmrta1 APN 4 89691913 missense probably benign 0.04
IGL02572:Dmrta1 APN 4 89691558 missense probably benign 0.01
IGL02875:Dmrta1 APN 4 89691748 missense possibly damaging 0.70
IGL02883:Dmrta1 APN 4 89688774 missense probably benign
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0394:Dmrta1 UTSW 4 89692039 missense probably damaging 1.00
R2093:Dmrta1 UTSW 4 89691505 missense probably benign
R2132:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R2133:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R2401:Dmrta1 UTSW 4 89691616 missense probably benign 0.00
R3694:Dmrta1 UTSW 4 89692178 nonsense probably null
R3695:Dmrta1 UTSW 4 89692178 nonsense probably null
R3891:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3892:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3929:Dmrta1 UTSW 4 89691444 nonsense probably null
R4620:Dmrta1 UTSW 4 89688784 missense probably benign 0.05
R4927:Dmrta1 UTSW 4 89691748 missense probably damaging 1.00
R4982:Dmrta1 UTSW 4 89688564 missense probably damaging 1.00
R5312:Dmrta1 UTSW 4 89692047 missense probably damaging 0.99
R5437:Dmrta1 UTSW 4 89691756 missense possibly damaging 0.71
R5637:Dmrta1 UTSW 4 89688831 missense probably benign
R6185:Dmrta1 UTSW 4 89691768 missense probably damaging 0.97
R6906:Dmrta1 UTSW 4 89691966 missense probably benign 0.06
R7156:Dmrta1 UTSW 4 89688463 missense probably damaging 0.99
R7201:Dmrta1 UTSW 4 89692171 nonsense probably null
R7862:Dmrta1 UTSW 4 89688324 missense probably benign 0.00
R7880:Dmrta1 UTSW 4 89688844 missense possibly damaging 0.95
Z1177:Dmrta1 UTSW 4 89688408 missense probably damaging 0.97
Z1177:Dmrta1 UTSW 4 89688454 missense probably benign 0.37
Z1177:Dmrta1 UTSW 4 89688498 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCTCTCGGAATTCTTACCAGG -3'
(R):5'- AGGCAATGCTGGAACCAGTC -3'

Sequencing Primer
(F):5'- CAGGATCTTTCCAGGTTACAAGC -3'
(R):5'- ACCAGTCCAGGTGTTAGGTAG -3'
Posted On2019-11-26