Incidental Mutation 'R7755:Ppargc1a'
ID597493
Institutional Source Beutler Lab
Gene Symbol Ppargc1a
Ensembl Gene ENSMUSG00000029167
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator 1 alpha
SynonymsA830037N07Rik, Gm11133, Pgco1, Pgc1, PPAR Gamma Coactivator-1, Pgc-1alpha, Pgc-1alphaa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R7755 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location51454250-51567726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51473541 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 582 (Y582F)
Ref Sequence ENSEMBL: ENSMUSP00000117040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031059] [ENSMUST00000132734] [ENSMUST00000151104] [ENSMUST00000196968]
PDB Structure
SF-1 LBD bound by phosphatidylcholine [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000031059
SMART Domains Protein: ENSMUSP00000138397
Gene: ENSMUSG00000029167

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 1e-7 PDB
Predicted Effect unknown
Transcript: ENSMUST00000132734
AA Change: Y582F
SMART Domains Protein: ENSMUSP00000117040
Gene: ENSMUSG00000029167
AA Change: Y582F

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
RRM 677 746 4.61e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151104
SMART Domains Protein: ENSMUSP00000116566
Gene: ENSMUSG00000029167

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
low complexity region 137 143 N/A INTRINSIC
PDB:3D24|D 193 214 1e-7 PDB
Predicted Effect unknown
Transcript: ENSMUST00000196968
AA Change: Y582F
SMART Domains Protein: ENSMUSP00000143553
Gene: ENSMUSG00000029167
AA Change: Y582F

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a transcriptional coactivator that induces and coordinates gene expression regulating mitochondrial biogenesis, respiration, hepatic gluconeogenesis, thermogenic program in brown fat and muscle fiber-type switching. Mice lacking the encoded protein exhibit reduced thermogenic capacity, hyperactivity and resistance to diet-induced obesity. Mice lacking the encoded protein specifically in the heart exhibit peripartum cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, abnormal glucose and insulin homeostasis, resistance to diet induced obesity, increased oxygen consumption, spongiform encephalopathy, hyperactivity, increased startle reflex, and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
4930402F06Rik T C 2: 35,376,337 Y107C probably damaging Het
Aff4 T C 11: 53,398,379 S452P probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Begain A G 12: 109,052,876 L215P probably benign Het
Carf T A 1: 60,148,055 S606T probably benign Het
Cngb3 A T 4: 19,461,684 T522S probably benign Het
Ctsll3 A T 13: 60,800,405 F153I probably damaging Het
Cubn G A 2: 13,280,078 T3509I probably benign Het
Dmrta1 T C 4: 89,691,933 S377P probably benign Het
Dnmbp G A 19: 43,850,086 A659V probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 T C 9: 7,015,490 D3598G probably benign Het
Fam35a T C 14: 34,248,890 K627E probably damaging Het
Flot2 T C 11: 78,049,513 F29L probably benign Het
Hectd1 A T 12: 51,802,220 I367K possibly damaging Het
Ikbkap T C 4: 56,774,552 N779S possibly damaging Het
Ivl T A 3: 92,572,010 K249N probably damaging Het
Kdelc1 T C 1: 44,118,573 probably benign Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Mbd4 T A 6: 115,844,585 I490F probably damaging Het
Mlip T C 9: 77,229,556 T690A probably benign Het
Mmp1a T A 9: 7,467,004 D227E possibly damaging Het
Mrgprf T C 7: 145,308,643 L314P probably damaging Het
Ndufb9 T G 15: 58,936,406 Y80* probably null Het
Neto2 C T 8: 85,669,656 R155H probably damaging Het
Npat T A 9: 53,559,170 N365K possibly damaging Het
Nsl1 G A 1: 191,063,183 V49M probably benign Het
Nudt21 T A 8: 94,022,865 Y191F probably benign Het
Olfr225 A G 11: 59,613,641 R226G probably damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Pcdh18 T C 3: 49,754,829 Y679C possibly damaging Het
Pkd1l3 A G 8: 109,630,166 D741G possibly damaging Het
Pkhd1 T C 1: 20,547,493 D956G probably damaging Het
Pparg C T 6: 115,463,106 P214S probably damaging Het
Prdm9 C T 17: 15,544,964 C518Y probably damaging Het
Rangrf T A 11: 68,973,714 E2V probably damaging Het
Rpl19 T C 11: 98,028,367 I45T probably benign Het
Rtn4rl2 T C 2: 84,872,463 D255G possibly damaging Het
Sirt3 T C 7: 140,878,050 D62G Het
Slc22a30 T C 19: 8,336,769 T518A probably damaging Het
Slc40a1 T C 1: 45,911,306 T329A probably damaging Het
Slc6a17 C T 3: 107,474,355 G470D probably damaging Het
Syne2 A T 12: 75,997,407 I3923L probably benign Het
Tiam2 C T 17: 3,421,316 S411L probably benign Het
Ticam1 A G 17: 56,270,182 C638R unknown Het
Tnrc6c A G 11: 117,758,086 T1528A probably benign Het
Ufl1 A G 4: 25,262,274 I404T probably benign Het
Usp43 A T 11: 67,891,468 S375T possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Vmn2r91 A T 17: 18,110,049 I532F possibly damaging Het
Vmn2r95 T C 17: 18,424,105 M1T probably null Het
Xirp2 T C 2: 67,515,182 V2589A probably benign Het
Zfp128 C T 7: 12,890,313 Q203* probably null Het
Other mutations in Ppargc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Ppargc1a APN 5 51498031 splice site probably null
IGL01063:Ppargc1a APN 5 51474322 missense probably benign 0.43
IGL01800:Ppargc1a APN 5 51494721 missense probably damaging 1.00
IGL02179:Ppargc1a APN 5 51473711 missense possibly damaging 0.90
IGL02336:Ppargc1a APN 5 51495726 nonsense probably null
IGL02368:Ppargc1a APN 5 51474156 missense probably benign 0.05
BB007:Ppargc1a UTSW 5 51472922 missense unknown
BB017:Ppargc1a UTSW 5 51472922 missense unknown
R1300:Ppargc1a UTSW 5 51548672 missense probably damaging 1.00
R2048:Ppargc1a UTSW 5 51548516 missense probably damaging 1.00
R2054:Ppargc1a UTSW 5 51473788 missense possibly damaging 0.47
R2211:Ppargc1a UTSW 5 51474259 missense possibly damaging 0.47
R2848:Ppargc1a UTSW 5 51473809 missense probably benign 0.02
R4094:Ppargc1a UTSW 5 51490064 missense possibly damaging 0.47
R4419:Ppargc1a UTSW 5 51494702 missense probably damaging 1.00
R4552:Ppargc1a UTSW 5 51463215 intron probably benign
R4702:Ppargc1a UTSW 5 51495696 missense possibly damaging 0.73
R4855:Ppargc1a UTSW 5 51474222 missense possibly damaging 0.89
R5287:Ppargc1a UTSW 5 51462825 intron probably benign
R5313:Ppargc1a UTSW 5 51458239 utr 3 prime probably benign
R5403:Ppargc1a UTSW 5 51462825 intron probably benign
R5711:Ppargc1a UTSW 5 51474220 missense probably damaging 1.00
R5918:Ppargc1a UTSW 5 51463237 intron probably benign
R5940:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6170:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6415:Ppargc1a UTSW 5 51462834 intron probably benign
R7718:Ppargc1a UTSW 5 51498162 missense probably damaging 1.00
R7793:Ppargc1a UTSW 5 51462509 splice site probably null
R7849:Ppargc1a UTSW 5 51548513 missense probably benign 0.45
R7930:Ppargc1a UTSW 5 51472922 missense unknown
R8169:Ppargc1a UTSW 5 51473684 missense probably benign 0.19
X0019:Ppargc1a UTSW 5 51548678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCCTCAGAGCAAGGTG -3'
(R):5'- TAAACTGAGCTACCCTTGGGATG -3'

Sequencing Primer
(F):5'- TCCTCAGAGCAAGGTGTGTGAG -3'
(R):5'- TACCCTTGGGATGGCACG -3'
Posted On2019-11-26