Incidental Mutation 'R0632:Dsg1c'
ID 59751
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Name desmoglein 1 gamma
Synonyms Dsg6
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20380397-20418088 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 20405403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
AlphaFold Q7TSF0
Predicted Effect probably benign
Transcript: ENSMUST00000054128
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20,407,733 (GRCm39) missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20,414,899 (GRCm39) splice site probably benign
IGL01412:Dsg1c APN 18 20,380,518 (GRCm39) missense probably benign
IGL02037:Dsg1c APN 18 20,410,007 (GRCm39) missense probably benign 0.02
IGL02247:Dsg1c APN 18 20,397,373 (GRCm39) missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20,410,056 (GRCm39) missense probably benign
IGL02408:Dsg1c APN 18 20,407,776 (GRCm39) missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20,416,790 (GRCm39) missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20,408,249 (GRCm39) missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20,407,887 (GRCm39) missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20,400,986 (GRCm39) missense probably benign 0.07
IGL03335:Dsg1c APN 18 20,416,754 (GRCm39) missense probably benign 0.01
Nancy UTSW 18 20,416,171 (GRCm39) missense probably damaging 1.00
R0385:Dsg1c UTSW 18 20,416,711 (GRCm39) missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20,407,832 (GRCm39) missense probably benign 0.04
R0570:Dsg1c UTSW 18 20,403,435 (GRCm39) missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20,412,298 (GRCm39) missense probably benign 0.02
R0621:Dsg1c UTSW 18 20,412,752 (GRCm39) missense possibly damaging 0.62
R1183:Dsg1c UTSW 18 20,416,255 (GRCm39) missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20,415,080 (GRCm39) missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20,415,104 (GRCm39) missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20,397,899 (GRCm39) missense probably benign 0.36
R1623:Dsg1c UTSW 18 20,408,234 (GRCm39) missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20,416,096 (GRCm39) splice site probably null
R1881:Dsg1c UTSW 18 20,405,597 (GRCm39) splice site probably benign
R2017:Dsg1c UTSW 18 20,399,253 (GRCm39) missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20,408,309 (GRCm39) missense probably benign 0.09
R2319:Dsg1c UTSW 18 20,408,235 (GRCm39) missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20,400,945 (GRCm39) missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20,403,407 (GRCm39) missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20,415,115 (GRCm39) critical splice donor site probably null
R3874:Dsg1c UTSW 18 20,410,109 (GRCm39) missense probably benign 0.02
R3910:Dsg1c UTSW 18 20,399,253 (GRCm39) missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20,408,322 (GRCm39) missense probably benign 0.01
R4739:Dsg1c UTSW 18 20,408,246 (GRCm39) missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20,397,901 (GRCm39) missense probably benign 0.00
R5165:Dsg1c UTSW 18 20,410,080 (GRCm39) missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20,407,758 (GRCm39) missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20,405,436 (GRCm39) missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20,400,994 (GRCm39) missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20,416,703 (GRCm39) missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20,415,088 (GRCm39) missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20,405,568 (GRCm39) missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20,416,270 (GRCm39) missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20,405,408 (GRCm39) missense probably benign 0.06
R5889:Dsg1c UTSW 18 20,416,658 (GRCm39) missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20,407,687 (GRCm39) missense probably benign 0.01
R6596:Dsg1c UTSW 18 20,403,581 (GRCm39) splice site probably null
R6941:Dsg1c UTSW 18 20,400,980 (GRCm39) missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20,399,201 (GRCm39) missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20,410,066 (GRCm39) missense probably benign
R7240:Dsg1c UTSW 18 20,416,166 (GRCm39) missense probably damaging 1.00
R8048:Dsg1c UTSW 18 20,407,824 (GRCm39) missense probably damaging 1.00
R8092:Dsg1c UTSW 18 20,415,029 (GRCm39) missense probably damaging 1.00
R8103:Dsg1c UTSW 18 20,416,171 (GRCm39) missense probably damaging 1.00
R8117:Dsg1c UTSW 18 20,410,016 (GRCm39) missense probably benign
R8192:Dsg1c UTSW 18 20,399,255 (GRCm39) missense probably damaging 1.00
R8801:Dsg1c UTSW 18 20,410,022 (GRCm39) missense probably benign 0.00
R9059:Dsg1c UTSW 18 20,408,306 (GRCm39) missense probably damaging 1.00
R9152:Dsg1c UTSW 18 20,416,329 (GRCm39) missense probably benign 0.06
R9292:Dsg1c UTSW 18 20,416,775 (GRCm39) missense probably damaging 1.00
R9469:Dsg1c UTSW 18 20,400,947 (GRCm39) missense probably damaging 1.00
R9596:Dsg1c UTSW 18 20,416,361 (GRCm39) missense probably benign 0.17
R9619:Dsg1c UTSW 18 20,416,499 (GRCm39) missense probably damaging 1.00
R9628:Dsg1c UTSW 18 20,397,373 (GRCm39) missense probably damaging 1.00
R9710:Dsg1c UTSW 18 20,410,044 (GRCm39) missense probably benign
X0026:Dsg1c UTSW 18 20,416,315 (GRCm39) missense probably damaging 1.00
Z1176:Dsg1c UTSW 18 20,416,630 (GRCm39) missense probably damaging 1.00
Z1177:Dsg1c UTSW 18 20,398,006 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAGTCATCTGTAAGCAGTCCTTC -3'
(R):5'- CCATACCTTGACAACCTTCAGAGTTCC -3'

Sequencing Primer
(F):5'- TAGGAACTCATTCAGTGTGCAG -3'
(R):5'- GACAACCTTCAGAGTTCCTACATTTG -3'
Posted On 2013-07-11