Incidental Mutation 'R7755:Rangrf'
ID597511
Institutional Source Beutler Lab
Gene Symbol Rangrf
Ensembl Gene ENSMUSG00000032892
Gene NameRAN guanine nucleotide release factor
SynonymsRangnrf, Mog1, 2400006H24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R7755 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68972484-68975185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68973714 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 2 (E2V)
Ref Sequence ENSEMBL: ENSMUSP00000038485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018884] [ENSMUST00000038644] [ENSMUST00000102606]
Predicted Effect probably benign
Transcript: ENSMUST00000018884
SMART Domains Protein: ENSMUSP00000018884
Gene: ENSMUSG00000018740

DomainStartEndE-ValueType
Pfam:Mito_carr 1 90 4.5e-20 PFAM
Pfam:Mito_carr 98 193 2.2e-16 PFAM
Pfam:Mito_carr 197 295 6.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038644
AA Change: E2V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038485
Gene: ENSMUSG00000032892
AA Change: E2V

DomainStartEndE-ValueType
Pfam:Mog1 7 145 1.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102606
SMART Domains Protein: ENSMUSP00000099666
Gene: ENSMUSG00000018740

DomainStartEndE-ValueType
Pfam:Mito_carr 1 92 7.9e-17 PFAM
Pfam:Mito_carr 98 197 1.2e-16 PFAM
Pfam:Mito_carr 202 299 8.6e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been shown to function as a guanine nucleotide release factor in mouse and to regulate the expression and function of the Nav1.5 cardiac sodium channel in human. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
4930402F06Rik T C 2: 35,376,337 Y107C probably damaging Het
Aff4 T C 11: 53,398,379 S452P probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Begain A G 12: 109,052,876 L215P probably benign Het
Carf T A 1: 60,148,055 S606T probably benign Het
Cngb3 A T 4: 19,461,684 T522S probably benign Het
Ctsll3 A T 13: 60,800,405 F153I probably damaging Het
Cubn G A 2: 13,280,078 T3509I probably benign Het
Dmrta1 T C 4: 89,691,933 S377P probably benign Het
Dnmbp G A 19: 43,850,086 A659V probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 T C 9: 7,015,490 D3598G probably benign Het
Fam35a T C 14: 34,248,890 K627E probably damaging Het
Flot2 T C 11: 78,049,513 F29L probably benign Het
Hectd1 A T 12: 51,802,220 I367K possibly damaging Het
Ikbkap T C 4: 56,774,552 N779S possibly damaging Het
Ivl T A 3: 92,572,010 K249N probably damaging Het
Kdelc1 T C 1: 44,118,573 probably benign Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Mbd4 T A 6: 115,844,585 I490F probably damaging Het
Mlip T C 9: 77,229,556 T690A probably benign Het
Mmp1a T A 9: 7,467,004 D227E possibly damaging Het
Mrgprf T C 7: 145,308,643 L314P probably damaging Het
Ndufb9 T G 15: 58,936,406 Y80* probably null Het
Neto2 C T 8: 85,669,656 R155H probably damaging Het
Npat T A 9: 53,559,170 N365K possibly damaging Het
Nsl1 G A 1: 191,063,183 V49M probably benign Het
Nudt21 T A 8: 94,022,865 Y191F probably benign Het
Olfr225 A G 11: 59,613,641 R226G probably damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Pcdh18 T C 3: 49,754,829 Y679C possibly damaging Het
Pkd1l3 A G 8: 109,630,166 D741G possibly damaging Het
Pkhd1 T C 1: 20,547,493 D956G probably damaging Het
Pparg C T 6: 115,463,106 P214S probably damaging Het
Ppargc1a T A 5: 51,473,541 Y582F unknown Het
Prdm9 C T 17: 15,544,964 C518Y probably damaging Het
Rpl19 T C 11: 98,028,367 I45T probably benign Het
Rtn4rl2 T C 2: 84,872,463 D255G possibly damaging Het
Sirt3 T C 7: 140,878,050 D62G Het
Slc22a30 T C 19: 8,336,769 T518A probably damaging Het
Slc40a1 T C 1: 45,911,306 T329A probably damaging Het
Slc6a17 C T 3: 107,474,355 G470D probably damaging Het
Syne2 A T 12: 75,997,407 I3923L probably benign Het
Tiam2 C T 17: 3,421,316 S411L probably benign Het
Ticam1 A G 17: 56,270,182 C638R unknown Het
Tnrc6c A G 11: 117,758,086 T1528A probably benign Het
Ufl1 A G 4: 25,262,274 I404T probably benign Het
Usp43 A T 11: 67,891,468 S375T possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Vmn2r91 A T 17: 18,110,049 I532F possibly damaging Het
Vmn2r95 T C 17: 18,424,105 M1T probably null Het
Xirp2 T C 2: 67,515,182 V2589A probably benign Het
Zfp128 C T 7: 12,890,313 Q203* probably null Het
Other mutations in Rangrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02431:Rangrf APN 11 68972739 missense probably benign 0.00
R0611:Rangrf UTSW 11 68972692 missense probably benign 0.13
R4450:Rangrf UTSW 11 68975184 unclassified probably benign
R4850:Rangrf UTSW 11 68973640 critical splice donor site probably null
R6341:Rangrf UTSW 11 68972712 missense probably benign 0.23
R6453:Rangrf UTSW 11 68973552 missense probably damaging 1.00
R6526:Rangrf UTSW 11 68973688 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCTTGGTTGTCTGGCAC -3'
(R):5'- TTTCCAAAGAGCCGGGCTTC -3'

Sequencing Primer
(F):5'- TTGTCTGGCACCGGTCG -3'
(R):5'- AGCCGGGCTTCAGAGACTAG -3'
Posted On2019-11-26