Incidental Mutation 'R7755:Flot2'
ID597512
Institutional Source Beutler Lab
Gene Symbol Flot2
Ensembl Gene ENSMUSG00000061981
Gene Nameflotillin 2
SynonymsEsa, reggie-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R7755 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78037931-78060434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78049513 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 29 (F29L)
Ref Sequence ENSEMBL: ENSMUSP00000072136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072289] [ENSMUST00000073660] [ENSMUST00000100784] [ENSMUST00000148162]
PDB Structure
Solution Structure of the Band 7 Domain of the mouse Flotillin 2 Protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000072289
AA Change: F29L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072136
Gene: ENSMUSG00000061981
AA Change: F29L

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073660
AA Change: F29L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000073342
Gene: ENSMUSG00000061981
AA Change: F29L

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 5.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100784
SMART Domains Protein: ENSMUSP00000098347
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 38 220 1.34e-10 SMART
Blast:PHB 277 347 2e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148162
AA Change: F29L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133147
Gene: ENSMUSG00000061981
AA Change: F29L

DomainStartEndE-ValueType
Blast:PHB 2 74 2e-34 BLAST
PDB:1WIN|A 40 74 2e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced metastase into the lungs in a breast cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
4930402F06Rik T C 2: 35,376,337 Y107C probably damaging Het
Aff4 T C 11: 53,398,379 S452P probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Begain A G 12: 109,052,876 L215P probably benign Het
Carf T A 1: 60,148,055 S606T probably benign Het
Cngb3 A T 4: 19,461,684 T522S probably benign Het
Ctsll3 A T 13: 60,800,405 F153I probably damaging Het
Cubn G A 2: 13,280,078 T3509I probably benign Het
Dmrta1 T C 4: 89,691,933 S377P probably benign Het
Dnmbp G A 19: 43,850,086 A659V probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 T C 9: 7,015,490 D3598G probably benign Het
Fam35a T C 14: 34,248,890 K627E probably damaging Het
Hectd1 A T 12: 51,802,220 I367K possibly damaging Het
Ikbkap T C 4: 56,774,552 N779S possibly damaging Het
Ivl T A 3: 92,572,010 K249N probably damaging Het
Kdelc1 T C 1: 44,118,573 probably benign Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Mbd4 T A 6: 115,844,585 I490F probably damaging Het
Mlip T C 9: 77,229,556 T690A probably benign Het
Mmp1a T A 9: 7,467,004 D227E possibly damaging Het
Mrgprf T C 7: 145,308,643 L314P probably damaging Het
Ndufb9 T G 15: 58,936,406 Y80* probably null Het
Neto2 C T 8: 85,669,656 R155H probably damaging Het
Npat T A 9: 53,559,170 N365K possibly damaging Het
Nsl1 G A 1: 191,063,183 V49M probably benign Het
Nudt21 T A 8: 94,022,865 Y191F probably benign Het
Olfr225 A G 11: 59,613,641 R226G probably damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Pcdh18 T C 3: 49,754,829 Y679C possibly damaging Het
Pkd1l3 A G 8: 109,630,166 D741G possibly damaging Het
Pkhd1 T C 1: 20,547,493 D956G probably damaging Het
Pparg C T 6: 115,463,106 P214S probably damaging Het
Ppargc1a T A 5: 51,473,541 Y582F unknown Het
Prdm9 C T 17: 15,544,964 C518Y probably damaging Het
Rangrf T A 11: 68,973,714 E2V probably damaging Het
Rpl19 T C 11: 98,028,367 I45T probably benign Het
Rtn4rl2 T C 2: 84,872,463 D255G possibly damaging Het
Sirt3 T C 7: 140,878,050 D62G Het
Slc22a30 T C 19: 8,336,769 T518A probably damaging Het
Slc40a1 T C 1: 45,911,306 T329A probably damaging Het
Slc6a17 C T 3: 107,474,355 G470D probably damaging Het
Syne2 A T 12: 75,997,407 I3923L probably benign Het
Tiam2 C T 17: 3,421,316 S411L probably benign Het
Ticam1 A G 17: 56,270,182 C638R unknown Het
Tnrc6c A G 11: 117,758,086 T1528A probably benign Het
Ufl1 A G 4: 25,262,274 I404T probably benign Het
Usp43 A T 11: 67,891,468 S375T possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Vmn2r91 A T 17: 18,110,049 I532F possibly damaging Het
Vmn2r95 T C 17: 18,424,105 M1T probably null Het
Xirp2 T C 2: 67,515,182 V2589A probably benign Het
Zfp128 C T 7: 12,890,313 Q203* probably null Het
Other mutations in Flot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Flot2 APN 11 78049507 missense probably damaging 1.00
IGL02965:Flot2 APN 11 78059205 missense possibly damaging 0.50
PIT4382001:Flot2 UTSW 11 78053367 missense possibly damaging 0.85
R0330:Flot2 UTSW 11 78058958 missense possibly damaging 0.94
R1200:Flot2 UTSW 11 78054805 missense probably damaging 1.00
R1700:Flot2 UTSW 11 78049547 missense possibly damaging 0.88
R1701:Flot2 UTSW 11 78049547 missense possibly damaging 0.88
R1735:Flot2 UTSW 11 78058005 missense probably benign 0.05
R1992:Flot2 UTSW 11 78058619 missense probably damaging 0.97
R4812:Flot2 UTSW 11 78053365 missense probably damaging 0.99
R4840:Flot2 UTSW 11 78057513 missense probably damaging 1.00
R4927:Flot2 UTSW 11 78059062 missense probably damaging 0.98
R5396:Flot2 UTSW 11 78049488 nonsense probably null
R6865:Flot2 UTSW 11 78049492 missense probably benign 0.05
R7085:Flot2 UTSW 11 78058074 missense possibly damaging 0.94
R7262:Flot2 UTSW 11 78057349 missense probably damaging 0.99
R7286:Flot2 UTSW 11 78054786 missense probably benign 0.05
R7350:Flot2 UTSW 11 78057976 missense probably damaging 1.00
R7359:Flot2 UTSW 11 78058557 missense probably benign 0.25
R7498:Flot2 UTSW 11 78053362 critical splice acceptor site probably null
R7701:Flot2 UTSW 11 78038116 splice site probably null
R7955:Flot2 UTSW 11 78058943 critical splice acceptor site probably null
R8273:Flot2 UTSW 11 78059195 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTAGGCTACATAGTAAGCC -3'
(R):5'- GAGCAACCCCTTTCTGTTTG -3'

Sequencing Primer
(F):5'- GCCTGATAACCTGAGTTAGATCC -3'
(R):5'- CCTTCTCGTGCCAGTTGGAG -3'
Posted On2019-11-26