Incidental Mutation 'R7755:Tnrc6c'
ID597514
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Nametrinucleotide repeat containing 6C
Synonyms9930033H14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7755 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location117654289-117763439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117758086 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1528 (T1528A)
Ref Sequence ENSEMBL: ENSMUSP00000115221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
Predicted Effect probably benign
Transcript: ENSMUST00000026658
AA Change: T1696A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: T1696A

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106344
AA Change: T1696A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: T1696A

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138299
AA Change: T1528A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: T1528A

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
4930402F06Rik T C 2: 35,376,337 Y107C probably damaging Het
Aff4 T C 11: 53,398,379 S452P probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Begain A G 12: 109,052,876 L215P probably benign Het
Carf T A 1: 60,148,055 S606T probably benign Het
Cngb3 A T 4: 19,461,684 T522S probably benign Het
Ctsll3 A T 13: 60,800,405 F153I probably damaging Het
Cubn G A 2: 13,280,078 T3509I probably benign Het
Dmrta1 T C 4: 89,691,933 S377P probably benign Het
Dnmbp G A 19: 43,850,086 A659V probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 T C 9: 7,015,490 D3598G probably benign Het
Fam35a T C 14: 34,248,890 K627E probably damaging Het
Flot2 T C 11: 78,049,513 F29L probably benign Het
Hectd1 A T 12: 51,802,220 I367K possibly damaging Het
Ikbkap T C 4: 56,774,552 N779S possibly damaging Het
Ivl T A 3: 92,572,010 K249N probably damaging Het
Kdelc1 T C 1: 44,118,573 probably benign Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Mbd4 T A 6: 115,844,585 I490F probably damaging Het
Mlip T C 9: 77,229,556 T690A probably benign Het
Mmp1a T A 9: 7,467,004 D227E possibly damaging Het
Mrgprf T C 7: 145,308,643 L314P probably damaging Het
Ndufb9 T G 15: 58,936,406 Y80* probably null Het
Neto2 C T 8: 85,669,656 R155H probably damaging Het
Npat T A 9: 53,559,170 N365K possibly damaging Het
Nsl1 G A 1: 191,063,183 V49M probably benign Het
Nudt21 T A 8: 94,022,865 Y191F probably benign Het
Olfr225 A G 11: 59,613,641 R226G probably damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Pcdh18 T C 3: 49,754,829 Y679C possibly damaging Het
Pkd1l3 A G 8: 109,630,166 D741G possibly damaging Het
Pkhd1 T C 1: 20,547,493 D956G probably damaging Het
Pparg C T 6: 115,463,106 P214S probably damaging Het
Ppargc1a T A 5: 51,473,541 Y582F unknown Het
Prdm9 C T 17: 15,544,964 C518Y probably damaging Het
Rangrf T A 11: 68,973,714 E2V probably damaging Het
Rpl19 T C 11: 98,028,367 I45T probably benign Het
Rtn4rl2 T C 2: 84,872,463 D255G possibly damaging Het
Sirt3 T C 7: 140,878,050 D62G Het
Slc22a30 T C 19: 8,336,769 T518A probably damaging Het
Slc40a1 T C 1: 45,911,306 T329A probably damaging Het
Slc6a17 C T 3: 107,474,355 G470D probably damaging Het
Syne2 A T 12: 75,997,407 I3923L probably benign Het
Tiam2 C T 17: 3,421,316 S411L probably benign Het
Ticam1 A G 17: 56,270,182 C638R unknown Het
Ufl1 A G 4: 25,262,274 I404T probably benign Het
Usp43 A T 11: 67,891,468 S375T possibly damaging Het
Vmn2r91 A T 17: 18,110,049 I532F possibly damaging Het
Vmn2r95 T C 17: 18,424,105 M1T probably null Het
Xirp2 T C 2: 67,515,182 V2589A probably benign Het
Zfp128 C T 7: 12,890,313 Q203* probably null Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117720971 missense probably benign
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117721046 missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117722519 missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117733618 missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117741780 missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117721954 missense probably benign
R7515:Tnrc6c UTSW 11 117741681 missense probably benign 0.03
R7665:Tnrc6c UTSW 11 117720951 missense possibly damaging 0.46
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Z1176:Tnrc6c UTSW 11 117732177 missense not run
Predicted Primers PCR Primer
(F):5'- TGTGATGTCAGTGTCCTGCC -3'
(R):5'- AGTATAAGATGCTCCCAGGCAC -3'

Sequencing Primer
(F):5'- CGGCCTGTAGACATGCATATACTG -3'
(R):5'- CAGGCACGGGGAGTCTGATG -3'
Posted On2019-11-26